View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_65 (Length: 485)

Name: J5_4_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_65
J5_4_65
[»] chr4 (1 HSPs)
chr4 (1-275)||(4032661-4032935)
[»] chr6 (1 HSPs)
chr6 (270-432)||(14879183-14879345)


Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 4032661 - 4032935
Alignment:
1 agctggacaagagtatcgagttccgaccaaactccggtcggaacctcaccggagaatttgttccttgctaaaataagcctctgaagctgcctacatttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4032661 agctggacaagagtatcgagttccgaccaaactccggtcggaacctcaccggagaatttgttccttgctaaaataagcctctgaagctgcctacatttct 4032760  T
101 ggatatcattcggaatatcaccagagaaagaattatcggagaggtcgagattctggagtcgtggaacggtgcagacagaagccggaaacggaccggagag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4032761 ggatatcattcggaatatcaccagagaaagaattatcggagaggtcgagattctggagtcgtggaacggtgcagacagaagccggaaacggaccggagag 4032860  T
201 attattccggtgaagaaaaatactatgaagtgcagtagcattaaacaactgaaccggaacaacaccatagaattc 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4032861 attattccggtgaagaaaaatactatgaagtgcagtagcattaaacaactgaaccggaacaacaccatagaattc 4032935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 160; Significance: 5e-85; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 270 - 432
Target Start/End: Complemental strand, 14879345 - 14879183
Alignment:
270 gaattccttcttgttttctcagatgtttgtttgaacaagttgttgactaatctttgaaccctttgagaaatgttgtaattctagaaagatatgtagattt 369  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14879345 gaattccttcttgttttctcagatgtttgtttgaacaagttgttgactaatctttgaaccctttgagaaatgttgtaattctagaaagatatgtagattt 14879246  T
370 ctttgccacttgtgttttcagatcataatttggaaaattcttaacacttgnatgtctttgctc 432  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
14879245 ctttgccacttgtgttttcagatcataatttggaaaattcttaacacttgtatgtctttgctc 14879183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108090 times since January 2019
Visitors: 1329