View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_7 (Length: 581)

Name: J5_4_7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_7
J5_4_7
[»] chr1 (6 HSPs)
chr1 (253-581)||(36396034-36396362)
chr1 (1-258)||(36396358-36396615)
chr1 (169-257)||(2943954-2944042)
chr1 (408-501)||(2944157-2944254)
chr1 (39-104)||(2944053-2944118)
chr1 (253-305)||(36395991-36396043)
[»] chr6 (1 HSPs)
chr6 (313-361)||(10781701-10781749)


Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 253 - 581
Target Start/End: Original strand, 36396034 - 36396362
Alignment:
253 attaataatgtcctgttctgtctgtatatcgtatagaattttgactaataatggtctgtgctcttgtattgctatgtgtgaaggattgtttgatagaggg 352  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36396034 attaataatgtcctgttctgtctgtatatcgtatagaattttgactaataatggtctgtgctcttgtattgctatgtgtgaaggattgtttgatagaggg 36396133  T
353 taatccaggaaatggtcccnatgagacatcggcttctggttgctcaaacagaacccttctcctaccttgctcttctaacatggatgcgtccgatgatgca 452  Q
    ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36396134 taatccaggaaatggtcccaatgaggcatcggcttctggttgctcaaacagaacccttctcctaccttgctcttctaacatggatgcgtccgatgatgca 36396233  T
453 ccattacctagtcaggctgttggcactatatcagctgccagtgaaactggtcatcaacttcctatgactgnggacactgcatcagctacaagcaaagctg 552  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
36396234 ccattacctagtcaggctgttggcactatatcagctgccagtgaaactggtcatcaacttcctatgactgtggacactgcatcagctacaagcaaagctg 36396333  T
553 ttattgagcttcccatcaagcccgtcaac 581  Q
    |||||||||||||||||||||||||||||    
36396334 ttattgagcttcccatcaagcccgtcaac 36396362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 240; E-Value: 1e-132
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 36396358 - 36396615
Alignment:
1 tcaacaattcagccaccaccagtcaaccaagtaatcaactttccattatggctgcagacactgaaacagctgcgagcaaaactgntaatgaacttcccat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
36396358 tcaacaattcagccaccaccagtcaaccaagtaatcaactttccattatggctgcagacactgaaacagctgcgagcaaaactgttaatgaacttcccat 36396457  T
101 caagcccgttgacacttcanctgtcaccagccaacctagtantccaccttccattaaggntgnaggcnctgtatctgcaaccaatgaaattaacaaccaa 200  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||    
36396458 caagcccgttgacacttcatctgtcaccagccaacctagtaatccaccttccattaaggctgtaggcactgtatctgcaaccaatgaaattaacaaccaa 36396557  T
201 gttcccagcaaggctattatagagactgtatcagcagacaatggatatggtaattaat 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36396558 gttcccagcaaggctattatagagactgtatcagcagacaatggatatggtaattaat 36396615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 169 - 257
Target Start/End: Complemental strand, 2944042 - 2943954
Alignment:
169 ctgtatctgcaaccaatgaaattaacaaccaagttcccagcaaggctattatagagactgtatcagcagacaatggatatggtaattaa 257  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
2944042 ctgtatctgcaaccaatgaaattaacaaccaagttcccatcaaggctattatagagactgtatcagcagacaatggatatggtaattaa 2943954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 408 - 501
Target Start/End: Complemental strand, 2944254 - 2944157
Alignment:
408 cttctcctacctt----gctcttctaacatggatgcgtccgatgatgcaccattacctagtcaggctgttggcactatatcagctgccagtgaaactg 501  Q
    |||||||||||||    |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2944254 cttctcctaccttgctagctcttctaacatggacgtgtccgatgatgcaccattacctagtcaggctgttggcactatatcagcagccagtgaaactg 2944157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 39 - 104
Target Start/End: Complemental strand, 2944118 - 2944053
Alignment:
39 ctttccattatggctgcagacactgaaacagctgcgagcaaaactgntaatgaacttcccatcaag 104  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||    
2944118 ctttccattatggctgaagacactgaaacagctgcgagcaaaactgttaatgaacttcccatcaag 2944053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 253 - 305
Target Start/End: Original strand, 36395991 - 36396043
Alignment:
253 attaataatgtcctgttctgtctgtatatcgtatagaattttgactaataatg 305  Q
    ||||||||||||||||| ||||||| |||||||||||||||||| ||||||||    
36395991 attaataatgtcctgttttgtctgtgtatcgtatagaattttgattaataatg 36396043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 313 - 361
Target Start/End: Complemental strand, 10781749 - 10781701
Alignment:
313 ctcttgtattgctatgtgtgaaggattgtttgatagagggtaatccagg 361  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||    
10781749 ctcttgtattcctatgtgtgaaggattgtttgatagagggtaatccagg 10781701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110414 times since January 2019
Visitors: 1335