View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_72 (Length: 200)

Name: J5_4_72
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_72
J5_4_72
[»] chr3 (1 HSPs)
chr3 (1-200)||(39933912-39934111)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 39934111 - 39933912
Alignment:
1 agatgatcaggtgtaggtgagtgtatgatgcacttgctgnnnnnnnnctttctttctcatccacaatatgagacctatatttatctcttccactatagaa 100  Q
    |||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||    
39934111 agatgatcaggtgtaggtgagtgtatgatgcacttgctgttttttttctttctttctcatccacaatatgagacctatatttatctcttccactatagaa 39934012  T
101 cccacccttgattgaagcataagtgaaacctattaaacttagccgtttagacccactatttatcttcctttttgtggatggcctcttgttgtttgcttca 200  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39934011 cccacccttgattgaagcataagtgaaacctattaaacttagtcgtttagacccactatttatcttcctttttgtggatggcctcttgttgtttgcttca 39933912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108234 times since January 2019
Visitors: 1329