View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_4_74 (Length: 67)
Name: J5_4_74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_4_74 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 35461 - 35527
Alignment:
Q |
1 |
ggtatactctccaatgctaccggttactcgtcttcatcaaagcatgtccctatgtgggagcttcttt |
67 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35461 |
ggtatactctccaatgctaccggttactcgtcttcatcaaagcatgtccctatgtgggagcttcttt |
35527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 204713 times since January 2019
Visitors: 1518