View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_74 (Length: 67)

Name: J5_4_74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_74
J5_4_74
[»] chr5 (1 HSPs)
chr5 (1-67)||(35461-35527)


Alignment Details
Target: chr5 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 35461 - 35527
Alignment:
1 ggtatactctccaatgctaccggttactcgtcttcatcaaagcatgtccctatgtgggagcttcttt 67  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35461 ggtatactctccaatgctaccggttactcgtcttcatcaaagcatgtccctatgtgggagcttcttt 35527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204713 times since January 2019
Visitors: 1518