View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_77 (Length: 181)

Name: J5_4_77
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_77
J5_4_77
[»] chr4 (1 HSPs)
chr4 (1-181)||(18015512-18015692)
[»] chr2 (4 HSPs)
chr2 (1-181)||(3063628-3063808)
chr2 (43-177)||(2466285-2466419)
chr2 (43-177)||(2462231-2462365)
chr2 (51-177)||(2457669-2457795)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 18015512 - 18015692
Alignment:
1 cacctaccataccatttatatttagccatatatacatggtagtaacagaaatgagttcattttctctattgtgtatcttggccttattactcgttattgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18015512 cacctaccataccatttatatttagccatatatacatggtagtaacagaaatgagttcattttctctattgtgtatcttggccttattactcgttattgg 18015611  T
101 tcatgtagcaaatgaccaaaactcacgagcagactatgtgaacgctcacaacgacgcaagacgtcaggttggtgttggaga 181  Q
    |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
18015612 tcatgtagcaaatgcccaaaactcacgagcagactatgtgaacgcccacaacgacgcaagacgtcaggttggtgttggaga 18015692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 3063808 - 3063628
Alignment:
1 cacctaccataccatttatatttagccatatatacatggtagtaacagaaatgagttcattttctctattgtgtatcttggccttattactcgttattgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3063808 cacctaccataccatttatatttagccatatatacatggtagtaacagaaatgagttcattttctctattgtgtatcttggccttattactcgttattgg 3063709  T
101 tcatgtagcaaatgaccaaaactcacgagcagactatgtgaacgctcacaacgacgcaagacgtcaggttggtgttggaga 181  Q
    |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
3063708 tcatgtagcaaatgcccaaaactcacgagcagactatgtgaacgcccacaacgacgcaagacgtcaggttggtgttggaga 3063628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 79; E-Value: 3e-37
Query Start/End: Original strand, 43 - 177
Target Start/End: Original strand, 2466285 - 2466419
Alignment:
43 taacagaaatgagttcattttctctattgtgtatcttggccttattactcgttattggtcatgtagcaaatgaccaaaactcacgagcagactatgtgaa 142  Q
    ||||| |||||||||||||||||||| ||||| |||||| |||||||||| ||||||||||||| ||| ||| |||| |||||| |||||||||||||||    
2466285 taacaaaaatgagttcattttctctactgtgtttcttgggcttattactcattattggtcatgttgcacatgcccaagactcacaagcagactatgtgaa 2466384  T
143 cgctcacaacgacgcaagacgtcaggttggtgttg 177  Q
    |||||||||||| ||||||  | ||||||||||||    
2466385 cgctcacaacgaagcaagatctgaggttggtgttg 2466419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 67; E-Value: 5e-30
Query Start/End: Original strand, 43 - 177
Target Start/End: Original strand, 2462231 - 2462365
Alignment:
43 taacagaaatgagttcattttctctattgtgtatcttggccttattactcgttattggtcatgtagcaaatgaccaaaactcacgagcagactatgtgaa 142  Q
    ||||| |||||||||||||||||||||||||| |  ||| |||||  ||| |||| | ||| || ||| ||| ||||||||||| | |||||||||||||    
2462231 taacaaaaatgagttcattttctctattgtgtgtgctgggcttatccctcattatggttcacgttgcacatgcccaaaactcacaatcagactatgtgaa 2462330  T
143 cgctcacaacgacgcaagacgtcaggttggtgttg 177  Q
    ||| |||||||||||||||||||||||||||||||    
2462331 cgcccacaacgacgcaagacgtcaggttggtgttg 2462365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 51 - 177
Target Start/End: Original strand, 2457669 - 2457795
Alignment:
51 atgagttcattttctctattgtgtatcttggccttattactcgttattggtcatgtagcaaatgaccaaaactcacgagcagactatgtgaacgctcaca 150  Q
    |||||||||||||||||| | ||| ||||||  |||||  || |||||||||| || ||| ||| ||||||||||| |||||||||||||||| | ||||    
2457669 atgagttcattttctctaatatgtgtcttgggtttatttatcattattggtcacgttgcacatgcccaaaactcacaagcagactatgtgaactcccaca 2457768  T
151 acgacgcaagacgtcaggttggtgttg 177  Q
    |||| ||||||||||||||||||||||    
2457769 acgaagcaagacgtcaggttggtgttg 2457795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108306 times since January 2019
Visitors: 1329