View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_1 (Length: 224)

Name: J5_8_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_1
J5_8_1
[»] chr4 (2 HSPs)
chr4 (1-144)||(35916021-35916164)
chr4 (139-224)||(35916160-35916245)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35916164 - 35916021
Alignment:
1 gattgtgctggttttcttgaacaaactggaaggccagtccttccagctttagctcaggttagccttattgtctatgatgttttgncagtacatatggata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
35916164 gattgtgctggttttcttgaacaaactggaaggccagtccttccagctttagctcaggttagccttattgtctatgatgttttgtcagtacatatggata 35916065  T
101 aagtgatcaagaaaaaacctaaactaagttaagccgacattaat 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
35916064 aagtgatcaagaaaaaacctaaactaagttaagccgacattaat 35916021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 139 - 224
Target Start/End: Complemental strand, 35916245 - 35916160
Alignment:
139 attaatgttgttgaangatacagaattggcgttgatggatggatgcgtgttccatctgtggaagatgtctttgcacttggggattg 224  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35916245 attaatgttgttgaatgatacagaattggcgttgatggatggatgcgtgttccatctgtggaagatgtctttgcacttggggattg 35916160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175900 times since January 2019
Visitors: 1577