View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_16 (Length: 370)

Name: J5_8_16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_16
J5_8_16
[»] chr6 (3 HSPs)
chr6 (1-189)||(17456021-17456209)
chr6 (183-370)||(17456205-17456392)
chr6 (264-362)||(17434972-17435073)


Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 17456209 - 17456021
Alignment:
1 gtgactgtgatttaaaatcttgatcactttgtagtataattcaattctttaaaaacttttcatgaggactaatttgcaagatttaccttttgatgattat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17456209 gtgactgtgatttaaaatcttgatcactttgtagtataattcaattctttaaaaacttttcatgaggactaatttgcaagatttaccttttgatgattat 17456110  T
101 attcatttaactgcataattctcaatggattttatgaacacagtacatttttcacaatctgttgtttaatatattcataatcattaatt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17456109 attcatttaactgcataattctcaatggattttatgaacacagtacatttttcacaatctgttgtttaatatattcataatcattaatt 17456021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 183 - 370
Target Start/End: Complemental strand, 17456392 - 17456205
Alignment:
183 attaatttatcctctgaatgaaaatgttagaggaactaattgtttattattttttgtcacggattaaatcgaaccatgagtaaattgcgaggattcaaat 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
17456392 attaatttatcctctgaatgaaaatgttagaggaactaattgtttattattttttgtcacggattaaatcgaaccatgagtaaattgtgaggattcaaat 17456293  T
283 tggatctttattcttaatttaaaggtttcgttgtgattgcaattgaagctgcatcaactttataaatttagttgtgtgacgatgtgac 370  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17456292 tggatctttattcttaatttaaaggtttcgttgtgattgcaattgaagctgcatcaactttataaatttagttgtgtgacgatgtgac 17456205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 264 - 362
Target Start/End: Complemental strand, 17435073 - 17434972
Alignment:
264 aaattgcgaggattcaaattggatctttattcttaattt---aaaggtttcgttgtgattgcaattgaagctgcatcaactttataaatttagttgtgtg 360  Q
    |||||| || |||||||||||||||||||||||||||||   |||||||| |||||||| ||||||||||||||||||||| | | ||||||||||||||    
17435073 aaattgtgaagattcaaattggatctttattcttaattttttaaaggttttgttgtgatagcaattgaagctgcatcaactgtgttaatttagttgtgtg 17434974  T
361 ac 362  Q
    ||    
17434973 ac 17434972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176005 times since January 2019
Visitors: 1577