View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_18 (Length: 454)

Name: J5_8_18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_18
J5_8_18
[»] chr3 (10 HSPs)
chr3 (1-265)||(47986591-47986855)
chr3 (1-265)||(47995878-47996142)
chr3 (1-265)||(48005165-48005429)
chr3 (1-265)||(48014450-48014714)
chr3 (260-378)||(47987363-47987481)
chr3 (260-378)||(47996650-47996768)
chr3 (260-378)||(48005937-48006055)
chr3 (311-378)||(48015222-48015289)
chr3 (38-104)||(6905806-6905872)
chr3 (44-104)||(32411083-32411143)
[»] chr6 (30 HSPs)
chr6 (39-140)||(5157472-5157573)
chr6 (36-126)||(5426043-5426133)
chr6 (41-140)||(5354458-5354557)
chr6 (36-126)||(5066552-5066642)
chr6 (36-126)||(5073766-5073856)
chr6 (139-259)||(5397215-5397335)
chr6 (35-112)||(5128289-5128366)
chr6 (41-111)||(5102487-5102557)
chr6 (45-117)||(5096850-5096922)
chr6 (44-126)||(5181785-5181867)
chr6 (36-104)||(5176872-5176940)
chr6 (36-104)||(5243793-5243861)
chr6 (36-104)||(5278699-5278767)
chr6 (36-112)||(5370704-5370780)
chr6 (36-140)||(5397083-5397187)
chr6 (35-104)||(5344993-5345062)
chr6 (35-104)||(5690039-5690108)
chr6 (138-234)||(5096972-5097068)
chr6 (36-112)||(5383459-5383535)
chr6 (168-259)||(5354310-5354401)
chr6 (36-126)||(5350527-5350611)
chr6 (187-259)||(5284082-5284154)
chr6 (143-233)||(5066416-5066506)
chr6 (178-259)||(5137362-5137443)
chr6 (143-259)||(5073604-5073720)
chr6 (143-259)||(5102310-5102426)
chr6 (36-111)||(5434168-5434243)
chr6 (178-259)||(5128113-5128194)
chr6 (36-109)||(5447720-5447793)
chr6 (153-213)||(5257070-5257130)
[»] chr5 (4 HSPs)
chr5 (36-109)||(8877742-8877815)
chr5 (47-102)||(20812421-20812476)
chr5 (44-102)||(12599054-12599112)
chr5 (44-102)||(20838773-20838831)
[»] chr7 (1 HSPs)
chr7 (36-106)||(36213707-36213777)
[»] scaffold0294 (1 HSPs)
scaffold0294 (36-117)||(8767-8848)
[»] chr4 (10 HSPs)
chr4 (44-106)||(4344787-4344849)
chr4 (35-101)||(4320502-4320568)
chr4 (44-106)||(4361218-4361280)
chr4 (35-112)||(4123811-4123888)
chr4 (44-109)||(4335486-4335551)
chr4 (48-109)||(6498401-6498462)
chr4 (38-105)||(6532111-6532178)
chr4 (41-109)||(6545323-6545391)
chr4 (41-109)||(6588071-6588139)
chr4 (41-109)||(6675841-6675909)
[»] chr8 (3 HSPs)
chr8 (49-102)||(3262629-3262682)
chr8 (48-104)||(3407323-3407379)
chr8 (44-101)||(3314999-3315056)
[»] scaffold0468 (1 HSPs)
scaffold0468 (38-104)||(6146-6212)


Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 10)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 47986855 - 47986591
Alignment:
1 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||    
47986855 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggtcttggatgtcacca 47986756  T
101 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47986755 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 47986656  T
201 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47986655 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 47986591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 47996142 - 47995878
Alignment:
1 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||    
47996142 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggtcttggatgtcacca 47996043  T
101 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47996042 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 47995943  T
201 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47995942 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 47995878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 48005429 - 48005165
Alignment:
1 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||    
48005429 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggtcttggatgtcacca 48005330  T
101 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48005329 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 48005230  T
201 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48005229 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 48005165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 48014714 - 48014450
Alignment:
1 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||    
48014714 ataacaagagtgcctttatcagtagtgaggtcacctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggtcttggatgtcacca 48014615  T
101 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48014614 acaaataatctcacatcaccatttcatgcacctgctgccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctt 48014515  T
201 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48014514 tgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgcattaat 48014450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 260 - 378
Target Start/End: Complemental strand, 47987481 - 47987363
Alignment:
260 attaatgcttaatttagcactttatctcatggtgaggtgcatgcctataagattgtgaactttttgtgaacaactaagaaattaggggatgattttaaat 359  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47987481 attaatgcttaatttagcactttatctcatggtgaggtgcatgcctataagattgtgaactttttgtgaacaactaagaaattaggggatgattttaaat 47987382  T
360 ttgatttatngcgaagtct 378  Q
    ||||||||| | |||||||    
47987381 ttgatttattgtgaagtct 47987363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 260 - 378
Target Start/End: Complemental strand, 47996768 - 47996650
Alignment:
260 attaatgcttaatttagcactttatctcatggtgaggtgcatgcctataagattgtgaactttttgtgaacaactaagaaattaggggatgattttaaat 359  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47996768 attaatgcttaatttagcactttatctcatggtgaggtgcatgcctataagattgtgaactttttgtgaacaactaagaaattaggggatgattttaaat 47996669  T
360 ttgatttatngcgaagtct 378  Q
    ||||||||| | |||||||    
47996668 ttgatttattgtgaagtct 47996650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 260 - 378
Target Start/End: Complemental strand, 48006055 - 48005937
Alignment:
260 attaatgcttaatttagcactttatctcatggtgaggtgcatgcctataagattgtgaactttttgtgaacaactaagaaattaggggatgattttaaat 359  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48006055 attaatgcttaatttagcactttatctcatggtgaggtgcatgcctataagattgtgaactttttgtgaacaactaagaaattaggggatgattttaaat 48005956  T
360 ttgatttatngcgaagtct 378  Q
    ||||||||| | |||||||    
48005955 ttgatttattgtgaagtct 48005937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 48015289 - 48015222
Alignment:
311 attgtgaactttttgtgaacaactaagaaattaggggatgattttaaatttgatttatngcgaagtct 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||    
48015289 attgtgaactttttgtgaacaactaagaaattaggggatgattttaaatttgatttattgtgaagtct 48015222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 104
Target Start/End: Complemental strand, 6905872 - 6905806
Alignment:
38 tgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||| ||||||||||| ||||||||| | ||||| ||| |||||||| ||| ||||||||||||||    
6905872 tgcggatatgaaggattatcacgtgatatttttccttctctcatttggtcttggatgtcaccaacaa 6905806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 44 - 104
Target Start/End: Complemental strand, 32411143 - 32411083
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||||||||| |||| ||| || ||||| ||| |||||||| ||||||||||||||||||    
32411143 tatgaaggattatcacatgaagtatttccctctctcatttggtcttagatgtcaccaacaa 32411083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 70; Significance: 2e-31; HSPs: 30)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 39 - 140
Target Start/End: Complemental strand, 5157573 - 5157472
Alignment:
39 gcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttcatgcacctgctgc 138  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||| ||||||||  || |||||||    
5157573 gcggctatgaaggattttctcgtgatgtgtttccatctatcatttggtcttggatgtcaccaacaaataatctcccatctccatttcaaacatctgctgc 5157474  T
139 ca 140  Q
    ||    
5157473 ca 5157472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 36 - 126
Target Start/End: Original strand, 5426043 - 5426133
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttca 126  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||||| ||| |||||||||||||||||||||| |||| ||||||||    
5426043 tgtgcggctatgaaggattttcacgtgatgtgtttccagcgatcatttggtcttggatgtcaccaacaaataatctcccatccccatttca 5426133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 41 - 140
Target Start/End: Complemental strand, 5354557 - 5354458
Alignment:
41 ggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttcatgcacctgctgcca 140  Q
    |||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||  ||| ||||||||  || |||||||||    
5354557 ggctatgaaggattctcacgtgatgtgtttccatctatcatttggtcttggatgtcaccaacaaataatctccgatctccatttcaaacatctgctgcca 5354458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 36 - 126
Target Start/End: Complemental strand, 5066642 - 5066552
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttca 126  Q
    ||||||||||||||||||| || ||||||||||||||||||||||||| | ||| |||||||||||||||||||||| |||| | ||||||    
5066642 tgtgcggctatgaaggattctcgcgtgatgtgtttccatctatcattttgtcttggatgtcaccaacaaataatctcccatccctatttca 5066552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 36 - 126
Target Start/End: Complemental strand, 5073856 - 5073766
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttca 126  Q
    ||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||| ||||||||| |||||||||||||| || ||||||||    
5073856 tgtgcggctatgaaggattctcacgtgatgtgttcccatcgatcatttggtcttggatgtcaccgacaaataatctcacttccccatttca 5073766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 139 - 259
Target Start/End: Original strand, 5397215 - 5397335
Alignment:
139 caagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctgga 238  Q
    ||||||||||||| || |||||||| || ||||| || || |||| |||||||||||||||||| ||||||||||| || |||  |||||||||||| ||    
5397215 caagtagtagttcgcacgaactatcatctttttcgaaacaacttccaaggcttcgaagtctttgcgtggattgcaattctgaagatcaactttctcttga 5397314  T
239 tgcaaaaaatattttggatgc 259  Q
    ||||||||  |||||||||||    
5397315 tgcaaaaataattttggatgc 5397335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 35 - 112
Target Start/End: Complemental strand, 5128366 - 5128289
Alignment:
35 ctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctc 112  Q
    ||||||||| |||||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||||||| |||||    
5128366 ctgtgcggccatgaaggattttcaagtgatgtgtttccatctatcatctggtcttggatgtcaccaacaaatgatctc 5128289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 41 - 111
Target Start/End: Complemental strand, 5102557 - 5102487
Alignment:
41 ggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatct 111  Q
    |||||||||||| |||||| ||||||||||||||||||||| ||| ||| |||||||||||||||||||||    
5102557 ggctatgaaggactttcacatgatgtgtttccatctatcatctggtcttggatgtcaccaacaaataatct 5102487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 45 - 117
Target Start/End: Original strand, 5096850 - 5096922
Alignment:
45 atgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatc 117  Q
    |||||||||||||||||||||||||||| |||||||| ||| ||| | |||||||||||||||||||| ||||    
5096850 atgaaggattttcacgtgatgtgtttccgtctatcatctggtcttggttgtcaccaacaaataatctctcatc 5096922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 44 - 126
Target Start/End: Complemental strand, 5181867 - 5181785
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttca 126  Q
    ||||||||||| |||| ||||||||||||| | ||||||||| ||| ||||||||| |||||||||||| |||| ||||||||    
5181867 tatgaaggattctcacatgatgtgtttccagcgatcatttggtcttggatgtcaccgacaaataatctcccatccccatttca 5181785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 104
Target Start/End: Original strand, 5176872 - 5176940
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||||||||||||||||| ||||||||| | |||||||| ||||||||| ||| ||||||||||||||    
5176872 tgtgcggctatgaaggattctcacgtgatatatttccatcaatcatttggtcttggatgtcaccaacaa 5176940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 104
Target Start/End: Complemental strand, 5243861 - 5243793
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    |||| |||||||||||||||||||| ||||| |||||||||||||| ||| ||| ||||||||||||||    
5243861 tgtgtggctatgaaggattttcacgcgatgtatttccatctatcatctggtcttggatgtcaccaacaa 5243793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 104
Target Start/End: Original strand, 5278699 - 5278767
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||||||||||||||||| ||||||||| | |||||||| ||||||||| ||| ||||||||||||||    
5278699 tgtgcggctatgaaggattctcacgtgatatatttccatcaatcatttggtcttggatgtcaccaacaa 5278767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 112
Target Start/End: Original strand, 5370704 - 5370780
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctc 112  Q
    |||| ||| ||| ||||||||||| |||||| |||||||||||||||||| ||| |||||||||||||||| |||||    
5370704 tgtgtggccatgtaggattttcacatgatgtttttccatctatcatttggtcttggatgtcaccaacaaattatctc 5370780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 140
Target Start/End: Original strand, 5397083 - 5397187
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttcatgcacctgc 135  Q
    ||||||| ||||||||||||||| |||| ||||||||| ||||||||| | ||| |||||||||||||| ||| ||| |||  ||||||||  || ||||    
5397083 tgtgcggatatgaaggattttcatgtgaagtgtttccagctatcatttcgtcttggatgtcaccaacaattaacctcccatttccatttcaaacatctgc 5397182  T
136 tgcca 140  Q
    |||||    
5397183 tgcca 5397187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 104
Target Start/End: Original strand, 5344993 - 5345062
Alignment:
35 ctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||| |||||||||||||| ||||| ||||| |||||||||||||| ||| ||| ||||||||||||||    
5344993 ctgtgtggctatgaaggattctcacgcgatgtatttccatctatcatctggtcttggatgtcaccaacaa 5345062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 104
Target Start/End: Complemental strand, 5690108 - 5690039
Alignment:
35 ctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||||||  |||||||||| ||||||||| | |||||||||||||||||| ||| ||||||||||||||    
5690108 ctgtgcggacatgaaggattctcacgtgatatatttccatctatcatttggtcttggatgtcaccaacaa 5690039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 138 - 234
Target Start/End: Original strand, 5096972 - 5097068
Alignment:
138 ccaagtagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctc 234  Q
    |||| ||||||||||||||||||||  ||  |||| ||  |||||| ||| |||||||||||||||||||| |||| |||||||  |||||||||||    
5096972 ccaaatagtagttcccatgaactattatcgatttccaagtaccttccaagtcttcgaagtctttgggtggagtgcagctcagaacttcaactttctc 5097068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 36 - 112
Target Start/End: Original strand, 5383459 - 5383535
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctc 112  Q
    |||||||| |||||||||| |||||||||||||||||||| ||||||  | ||| ||||||  ||||||||||||||    
5383459 tgtgcggccatgaaggattctcacgtgatgtgtttccatccatcattaagtcttggatgtcctcaacaaataatctc 5383535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 168 - 259
Target Start/End: Complemental strand, 5354401 - 5354310
Alignment:
168 ttttctaaccaccttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgc 259  Q
    |||||| ||||||||| ||| |||||||||||| ||||||||||||| || | |  |||||||||||| ||||||||||  |||||| ||||    
5354401 ttttctgaccaccttccaagacttcgaagtcttcgggtggattgcaattccgtagatcaactttctctagatgcaaaaacaattttgaatgc 5354310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 36 - 126
Target Start/End: Original strand, 5350527 - 5350611
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatcaccatttca 126  Q
    |||||||||||||||||||||||||||||||||||  |||  |||||    ||| |||||||||||||||||||| | |||| ||||||||    
5350527 tgtgcggctatgaaggattttcacgtgatgtgttt--atcattcatt----cttggatgtcaccaacaaataatcacccatccccatttca 5350611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 187 - 259
Target Start/End: Complemental strand, 5284154 - 5284082
Alignment:
187 ggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgc 259  Q
    |||||| |||||||||||||||||||||||| |||  |||||||||||| ||| ||| ||  |||||||||||    
5284154 ggcttcaaagtctttgggtggattgcaactccgaagatcaactttctcttgattcaacaatgattttggatgc 5284082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 143 - 233
Target Start/End: Complemental strand, 5066506 - 5066416
Alignment:
143 tagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttct 233  Q
    |||||| |||||||||||||| ||  |||| ||  |||||| ||| |||||||||||||||||||| ||||  ||||||  ||||||||||    
5066506 tagtagctcccatgaactatcatcaatttccaagtaccttccaagtcttcgaagtctttgggtggagtgcagttcagaacatcaactttct 5066416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 178 - 259
Target Start/End: Complemental strand, 5137443 - 5137362
Alignment:
178 accttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgc 259  Q
    |||||| ||| |||||||||||||||||||| ||||  |||||| ||||||||||||  ||||||  ||  |||||||||||    
5137443 accttccaagtcttcgaagtctttgggtggagtgcagttcagaacgtcaactttctcatgatgcagcaataattttggatgc 5137362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 259
Target Start/End: Complemental strand, 5073720 - 5073604
Alignment:
143 tagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctggatgca 242  Q
    ||||||||||||||||||||| ||  |||| ||  |||||| | |||||||| ||||||||||||| |||   ||| ||  |||||||||||  ||||||    
5073720 tagtagttcccatgaactatcatctatttccaattaccttccatggcttcgatgtctttgggtggaatgcggatcaaaacttcaactttctcaagatgca 5073621  T
243 aaaaatattttggatgc 259  Q
     |||  |||||||||||    
5073620 gaaagaattttggatgc 5073604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 259
Target Start/End: Complemental strand, 5102426 - 5102310
Alignment:
143 tagtagttcccatgaactatcctccttttctaaccaccttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctggatgca 242  Q
    |||||||||||| |||||||| ||  |||| |   |||||| ||  |||||||||||||||||||| ||||  |||||| ||||||||||||  ||||||    
5102426 tagtagttcccacgaactatcatcgatttccatgtaccttccaaatcttcgaagtctttgggtggagtgcagttcagaacgtcaactttctcatgatgca 5102327  T
243 aaaaatattttggatgc 259  Q
      ||  |||||||||||    
5102326 gcaataattttggatgc 5102310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 36 - 111
Target Start/End: Original strand, 5434168 - 5434243
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatct 111  Q
    ||||||| ||||||||||| ||||  ||| | ||||||| |||||||  | ||| |||||||||||||||||||||    
5434168 tgtgcggttatgaaggattctcacacgatttatttccatttatcattcagtcttggatgtcaccaacaaataatct 5434243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 178 - 259
Target Start/End: Complemental strand, 5128194 - 5128113
Alignment:
178 accttcaaaggcttcgaagtctttgggtggattgcaactcagaatgtcaactttctctggatgcaaaaaatattttggatgc 259  Q
    |||||| ||| ||||||||||||||| |||| |||| |||||||  |||||||||||  ||||||  ||  |||||||||||    
5128194 accttccaagtcttcgaagtctttggatggagtgcagctcagaacttcaactttctcatgatgcagcaataattttggatgc 5128113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 36 - 109
Target Start/End: Original strand, 5447720 - 5447793
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    ||||||| | ||||||||  || | |||||||||||||||||| ||| || ||| ||||||||||| |||||||    
5447720 tgtgcggatttgaaggatcctcgcatgatgtgtttccatctattattcggtcttggatgtcaccaagaaataat 5447793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 153 - 213
Target Start/End: Complemental strand, 5257130 - 5257070
Alignment:
153 catgaactatcctccttttctaaccaccttcaaaggcttcgaagtctttgggtggattgca 213  Q
    |||||||| || || ||||| ||||| |||| |||||||  ||||||||||||||||||||    
5257130 catgaactttcatctttttcgaaccaacttccaaggcttaaaagtctttgggtggattgca 5257070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 62; Significance: 1e-26; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 36 - 109
Target Start/End: Original strand, 8877742 - 8877815
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||    
8877742 tgtgcggctatgaaggattttcgcgtgatgtgtttccatctatcatttggtcttggatgtcaccaacaaataat 8877815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 47 - 102
Target Start/End: Original strand, 20812421 - 20812476
Alignment:
47 gaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaac 102  Q
    |||||||| ||||||||||| ||||| ||| |||||||| ||| ||||||||||||    
20812421 gaaggattatcacgtgatgtttttccttctctcatttggtcttggatgtcaccaac 20812476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 44 - 102
Target Start/End: Complemental strand, 12599112 - 12599054
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaac 102  Q
    ||||||||||| ||||||||||| ||||| ||| ||| |||| ||| ||||||||||||    
12599112 tatgaaggattatcacgtgatgtttttccttctctcaattggtcttggatgtcaccaac 12599054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 44 - 102
Target Start/End: Original strand, 20838773 - 20838831
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaac 102  Q
    ||||||||||| |||| |||||| ||||| ||| |||||||| ||| ||||||||||||    
20838773 tatgaaggattatcacatgatgtttttccttctctcatttggtcttggatgtcaccaac 20838831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 36 - 106
Target Start/End: Complemental strand, 36213777 - 36213707
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaat 106  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||||||| ||| ||||||||||||||||    
36213777 tgtgcggctatgaaggattctcacatgatgtgtttccatctatcatttggtcttggatgtcaccaacaaat 36213707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0294 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0294
Description:

Target: scaffold0294; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 36 - 117
Target Start/End: Complemental strand, 8848 - 8767
Alignment:
36 tgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctcacatc 117  Q
    |||||||| |||||||||| |||||||||||||||||||||||||||  | ||| |||||| ||||||||||||||| ||||    
8848 tgtgcggccatgaaggattctcacgtgatgtgtttccatctatcattaagtcttggatgtctccaacaaataatctcccatc 8767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 10)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 44 - 106
Target Start/End: Original strand, 4344787 - 4344849
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaat 106  Q
    ||||||||||| ||||||||||||||||| |||||||||||| ||| ||||||||||||||||    
4344787 tatgaaggattctcacgtgatgtgtttccttctatcatttggtcttggatgtcaccaacaaat 4344849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 4320568 - 4320502
Alignment:
35 ctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaa 101  Q
    ||||| || ||||||||||| ||||||||||||||||| |||||||||||| ||| |||||||||||    
4320568 ctgtgtggatatgaaggattctcacgtgatgtgtttccttctatcatttggtcttggatgtcaccaa 4320502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 44 - 106
Target Start/End: Original strand, 4361218 - 4361280
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaat 106  Q
    ||||||||||| ||||||||||||||||| |||||||||| | ||| ||||||||||||||||    
4361218 tatgaaggattctcacgtgatgtgtttccttctatcatttcgtcttggatgtcaccaacaaat 4361280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 112
Target Start/End: Complemental strand, 4123888 - 4123811
Alignment:
35 ctgtgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataatctc 112  Q
    ||||| || ||||||||||| || |||||||||||||| |||||||||| | ||| ||||| ||||||||||||||||    
4123888 ctgtgtggatatgaaggattctctcgtgatgtgtttccttctatcatttcgtcttggatgttaccaacaaataatctc 4123811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 44 - 109
Target Start/End: Original strand, 4335486 - 4335551
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    ||||||||||| || |||||||||||||| ||||| |||||| ||| ||||  |||||||||||||    
4335486 tatgaaggattctcccgtgatgtgtttccttctataatttggtcttggatggtaccaacaaataat 4335551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 6498462 - 6498401
Alignment:
48 aaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    ||||||||||||||||||| ||||| ||| ||||| || ||| |||||||||| ||||||||    
6498462 aaggattttcacgtgatgtatttccttctctcattcggtcttggatgtcaccatcaaataat 6498401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 38 - 105
Target Start/End: Complemental strand, 6532178 - 6532111
Alignment:
38 tgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaa 105  Q
    ||||||| |||||||||||||  |||||| ||||| ||||||||| || ||| |||||||||| ||||    
6532178 tgcggctttgaaggattttcaaatgatgtatttccttctatcattcggtcttggatgtcaccatcaaa 6532111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 41 - 109
Target Start/End: Complemental strand, 6545391 - 6545323
Alignment:
41 ggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    |||| ||||||||||||||||||||| || || ||| ||||| || ||| | |||||||| ||||||||    
6545391 ggctttgaaggattttcacgtgatgtattcccttctctcattcggtcttggctgtcaccatcaaataat 6545323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 41 - 109
Target Start/End: Complemental strand, 6588139 - 6588071
Alignment:
41 ggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    |||| ||||||||||||||||||||| || || ||| ||||| || ||| |||||| ||| ||||||||    
6588139 ggctttgaaggattttcacgtgatgtattcccttctctcattcggtcttggatgtcgccatcaaataat 6588071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 41 - 109
Target Start/End: Original strand, 6675841 - 6675909
Alignment:
41 ggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaaataat 109  Q
    |||| |||||||||||||| |||||| ||||| ||| |||||  | ||| |||||||||| ||||||||    
6675841 ggctttgaaggattttcacttgatgtatttccttctctcattaagtcttggatgtcaccatcaaataat 6675909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 49 - 102
Target Start/End: Complemental strand, 3262682 - 3262629
Alignment:
49 aggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaac 102  Q
    |||||||||||||||||| ||||| |||||||||||| ||| ||||||||||||    
3262682 aggattttcacgtgatgtttttccctctatcatttggtcttggatgtcaccaac 3262629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 48 - 104
Target Start/End: Complemental strand, 3407379 - 3407323
Alignment:
48 aaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||||| ||||||||||| ||||| |||||||||||| ||| ||||||||||||||    
3407379 aaggattatcacgtgatgtttttccttctatcatttggtcttggatgtcaccaacaa 3407323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 44 - 101
Target Start/End: Original strand, 3314999 - 3315056
Alignment:
44 tatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaa 101  Q
    |||||||| || ||||||||||| ||||| |||||||||||| ||| |||||||||||    
3314999 tatgaaggtttatcacgtgatgtttttccttctatcatttggtcttggatgtcaccaa 3315056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0468 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0468
Description:

Target: scaffold0468; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 38 - 104
Target Start/End: Complemental strand, 6212 - 6146
Alignment:
38 tgcggctatgaaggattttcacgtgatgtgtttccatctatcatttggccttagatgtcaccaacaa 104  Q
    ||||| ||||||||||| ||||||||||| ||||| ||  | |||||| ||| ||||||||||||||    
6212 tgcggatatgaaggattatcacgtgatgtttttccttcccttatttggtcttggatgtcaccaacaa 6146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360233 times since January 2019
Visitors: 482