View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_19 (Length: 206)

Name: J5_8_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_19
J5_8_19
[»] scaffold0007 (2 HSPs)
scaffold0007 (19-124)||(219370-219475)
scaffold0007 (118-206)||(219268-219356)


Alignment Details
Target: scaffold0007 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 219370 - 219475
Alignment:
19 attaaaaaattccagatgagatatgaatgatttgtgaaatcatatgatcttttatcttagttcttctccccctattatattttgtggtttagttgtggta 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
219370 attaaaaaattccagatgagatatgaatgatttgtgaaatcatatgatcttttatcttagttcttctccccctattatattttgtggtttagttgtggta 219469  T
119 attaat 124  Q
    ||||||    
219470 attaat 219475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 118 - 206
Target Start/End: Original strand, 219268 - 219356
Alignment:
118 aattaattagtacatacttcattacatgttcctctctcctcataaaaattcaatgaaaagatgataaatttaaacatttatataaatag 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
219268 aattaattagtacatacttcattacatgttcctctctcctcataaaaattcaatgaaaagatgataaatttaaacatttatataaatag 219356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108130 times since January 2019
Visitors: 1329