View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_27 (Length: 593)

Name: J5_8_27
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_27
J5_8_27
[»] chr4 (2 HSPs)
chr4 (280-593)||(30007072-30007386)
chr4 (1-291)||(30006786-30007076)
[»] chr5 (3 HSPs)
chr5 (294-540)||(1319259-1319506)
chr5 (294-535)||(1281217-1281459)
chr5 (338-471)||(12551924-12552057)
[»] chr3 (2 HSPs)
chr3 (431-480)||(33695180-33695229)
chr3 (359-411)||(13994081-13994133)
[»] chr1 (2 HSPs)
chr1 (337-417)||(33732184-33732264)
chr1 (323-420)||(16138874-16138971)
[»] chr7 (1 HSPs)
chr7 (358-420)||(48892614-48892676)


Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 280 - 593
Target Start/End: Complemental strand, 30007386 - 30007072
Alignment:
280 attattattaatgacttacttattcccaagaacagcatgcaaattgatgattgttttctcttcttcatctgcgaattgtcctcttttgatatcaggtctt 379  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
30007386 attaatattaatgacttacttattcccaagaacagcatgcaaattgatgattgttttctcttcttcatctgtgaattgtcctcttttgatatcaggtctt 30007287  T
380 aaatagttagtccaccttagtctgcaacttttcccacatctgttcaatcctgctagctttggaagtgctctccaacttccatggccatgtttcttaatgt 479  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30007286 aaatagttagtccaccttagtctgcaacttttcccacatctgttcaatcctgctagctttggaagtgctctccaacttccatggccatgtttcttaatgt 30007187  T
480 gattcaccaatattctgtcctcttctggtgtccaaggtcccttcttc-aaccactttcatcacagcatggtgctctccccatcatcaccagcagtagcac 578  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30007186 gattcaccaatattctgtcctcttctggtgtccaaggtcccttcttcaaaccactttcatcacagcatggtgctctccccatcatcaccagcagtagcac 30007087  T
579 tgcacaaacataaag 593  Q
    |||||||||||||||    
30007086 tgcacaaacataaag 30007072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 30007076 - 30006786
Alignment:
1 taaaggatatatataaattaaaagaatttagtttaaggaatagttacgatgattacaaaagagagtaatatgactccatacctaggagtgtttgaaatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30007076 taaaggatatatataaattaaaagaatttagtttaaggaatagttacgatgattacaaaagagagtaatatgactccatacctaggagtgtttgaaatgg 30006977  T
101 agaatgtattacggtatgtagacttatagtacaattatgttggaactaacttggctaaatagcataggagctttgttatatatagtatggtgatgtgtga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30006976 agaatgtattacggtatgtagacttatagtacaattatgttggaactaacttggctaaatagcataggagctttgttatatatagtatggtgatgtgtga 30006877  T
201 tgtttggagtgtttatgctttctaagactttgttaagttttataatgctatcatttnnnnnnntaattgaaaaagagaaattattattaat 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
30006876 tgtttggagtgtttatgctttctaagactttgttaagttttataatgctatcatttaaaaaaataattgaaaaagagaaattattattaat 30006786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 96; Significance: 9e-47; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 294 - 540
Target Start/End: Original strand, 1319259 - 1319506
Alignment:
294 cttacttattcccaagaacagcatgcaaattgatgattgttttctcttcttcatctgcgaattgtcctcttttgatatcaggtcttaaatagttagtcca 393  Q
    |||||||||| |||||||| | ||| |||||||||||    || ||||||||||| | ||||| ||||||| | |||||||| |||| ||| ||| ||||    
1319259 cttacttatttccaagaactgaatgtaaattgatgatgagattttcttcttcatcagagaattttcctcttctaatatcaggccttagataattattcca 1319358  T
394 ccttagtctgcaacttttcccacatctgttcaatcctgctagctttggaagtgctctccaacttccatggccatgtttcttaatgtgattcaccaatatt 493  Q
     || ||||| ||||| || |||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||| ||| ||||||    
1319359 tctaagtctacaactctttccacatctattcaatcctgcaagctttggaagagctctccaacttccatggccatgtttctgaatgtgatccactaatatt 1319458  T
494 ctgtcctcttctggtgtccaaggtcccttcttc-aaccactttcatca 540  Q
     | || ||||||||  |||| || ||||||||| ||||||||||||||    
1319459 ttatcttcttctggactccatggacccttcttcaaaccactttcatca 1319506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 294 - 535
Target Start/End: Complemental strand, 1281459 - 1281217
Alignment:
294 cttacttattcccaagaacagcatgcaaattgatgattgttttctcttcttcatctgcgaattgtcctcttttgatatcaggtcttaaatagttagtcca 393  Q
    |||||||||| |||||||| | ||| |||||||||||   || |||||||||||| |  ||||  |||||||| |||||||| |||||||| || |||||    
1281459 cttacttatttccaagaactgaatgtaaattgatgatgagttcctcttcttcatcagaaaatttccctcttttaatatcaggacttaaataatttgtcca 1281360  T
394 ccttagtctgcaacttttcccacatctgttcaatcctgctagctttggaagtgctctccaacttccatggccatgtttcttaatgtgattcaccaatatt 493  Q
     ||||  || ||||| || ||||||||||| ||||||||  || |||||||  ||||||||| |||| | |||||||||| |||||||| ||| ||| ||    
1281359 tcttaacctacaactctttccacatctgtttaatcctgcacgccttggaagatctctccaacgtccaggaccatgtttctgaatgtgatccactaatttt 1281260  T
494 ctgtcctcttctggtgtccaaggtcccttcttca-accacttt 535  Q
     | ||||||||||   |||| ||||||||||||| ||||||||    
1281259 ttatcctcttctgaactccatggtcccttcttcagaccacttt 1281217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 338 - 471
Target Start/End: Complemental strand, 12552057 - 12551924
Alignment:
338 tcttcttcatctgcgaattgtcctcttttgatatcaggtcttaaatagttagtccaccttagtctgcaacttttcccacatctgttcaatcctgctagct 437  Q
    ||||||||||| | |||||  ||||| ||||||||||| || ||||| || ||||||||||  || ||||| |||||||| || ||||| || ||  | |    
12552057 tcttcttcatcagtgaatttccctctcttgatatcaggcctcaaataatttgtccaccttaacctacaactcttcccacacctattcaaaccagcacgtt 12551958  T
438 ttggaagtgctctccaacttccatggccatgttt 471  Q
    ||| ||||| || |||| ||||||||||||||||    
12551957 ttgaaagtgttccccaatttccatggccatgttt 12551924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000009; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 431 - 480
Target Start/End: Complemental strand, 33695229 - 33695180
Alignment:
431 gctagctttggaagtgctctccaacttccatggccatgtttcttaatgtg 480  Q
    |||||||| || |||||||||||||||||||||||||||| || ||||||    
33695229 gctagcttagggagtgctctccaacttccatggccatgttgctgaatgtg 33695180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 359 - 411
Target Start/End: Original strand, 13994081 - 13994133
Alignment:
359 cctcttttgatatcaggtcttaaatagttagtccaccttagtctgcaactttt 411  Q
    |||||||||||| ||||||| | ||| |||||||| || ||||||||||||||    
13994081 cctcttttgataccaggtctaagataattagtccatctaagtctgcaactttt 13994133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 337 - 417
Target Start/End: Original strand, 33732184 - 33732264
Alignment:
337 ctcttcttcatctgcgaattgtcctcttttgatatcaggtcttaaatagttagtccaccttagtctgcaacttttcccaca 417  Q
    ||||||||||| || ||| | |||||| || ||||| ||||| ||||||||| ||||||| |||||||| ||||| |||||    
33732184 ctcttcttcatttgtgaaatttcctctcttaatatctggtctcaaatagttaatccacctaagtctgcagctttttccaca 33732264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 420
Target Start/End: Original strand, 16138874 - 16138971
Alignment:
323 ttgatgattgttttctcttcttcatctgcgaattgtcctcttttgatatcaggtcttaaatagttagtccaccttagtctgcaacttttcccacatct 420  Q
    |||||||| |||| ||||||||||| ||  || | |||||| || ||||||||| ||||||||||| |||| || | ||| ||||| || ||||||||    
16138874 ttgatgatagtttcctcttcttcatttgtaaaatttcctctcttaatatcaggttttaaatagttaatccatctcaatctacaactctttccacatct 16138971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 358 - 420
Target Start/End: Original strand, 48892614 - 48892676
Alignment:
358 tcctcttttgatatcaggtcttaaatagttagtccaccttagtctgcaacttttcccacatct 420  Q
    |||||| || ||||| ||||||| ||||||  |||| ||||||||||||||||| ||||||||    
48892614 tcctctctttatatctggtcttagatagttcatccatcttagtctgcaactttttccacatct 48892676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108390 times since January 2019
Visitors: 1329