View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_38 (Length: 642)

Name: J5_8_38
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_38
J5_8_38
[»] chr1 (2 HSPs)
chr1 (1-525)||(40756116-40756640)
chr1 (519-642)||(40755996-40756120)


Alignment Details
Target: chr1 (Bit Score: 525; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 525; E-Value: 0
Query Start/End: Original strand, 1 - 525
Target Start/End: Original strand, 40756116 - 40756640
Alignment:
1 gaaatgtcactggagtttagaaaactgtttccttgggttgaactaagggcgggttatggactaacagaaagttgcgggggagctacgtttttcggatcgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40756116 gaaatgtcactggagtttagaaaactgtttccttgggttgaactaagggcgggttatggactaacagaaagttgcgggggagctacgtttttcggatcgg 40756215  T
101 ataaagatgctaaagctcatccagaagcatgtggaaagttgattccaactttttgtgcaaaagtggtagacattgaaacagggaagcctttgcctccact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40756216 ataaagatgctaaagctcatccagaagcatgtggaaagttgattccaactttttgtgcaaaagtggtagacattgaaacagggaagcctttgcctccact 40756315  T
201 caaggaaggagagttatggttgaaaagcggtactattatgaaagaatatttaggaaatattgaggcaacaactgcaacaattgattcagaaggttggttg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40756316 caaggaaggagagttatggttgaaaagcggtactattatgaaagaatatttaggaaatattgaggcaacaactgcaacaattgattcagaaggttggttg 40756415  T
301 aggacaggtgatcttggttatattgatgagaatggaattgtctacatagtcgaacgaataaaggagctaatcaagcacaaagggtatcaggtactcaaat 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40756416 aggacaggtgatcttggttatattgatgagaatggaattgtctacatagtcgaacgaataaaggagctaatcaagcacaaagggtatcaggtactcaaat 40756515  T
401 tcataaatagtttaagtttcaatagtgaagttttgttgcacttgaagttaaattagaatatcagtaaattcctttagttctaaggtatcaaattgagttt 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40756516 tcataaatagtttaagtttcaatagtgaagttttgttgcacttgaagttaaattagaatatcagtaaattcctttagttctaaggtatcaaattgagttt 40756615  T
501 ggaacggttttagttttcattaata 525  Q
    |||||||||||||||||||||||||    
40756616 ggaacggttttagttttcattaata 40756640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 519 - 642
Target Start/End: Original strand, 40755996 - 40756120
Alignment:
519 attaataacataccggcagtgccaccagtgatccnctcattagtgaaacatgctagcaaagatggttgtgatttgtctagcctaa-aanagttggctcag 617  Q
    |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||    
40755996 attaataacataccagcagtgccaccagtgatccactcattagtgaaacatgctagcaaagatggttgtgatttgtctagcctaagaagagttggctcag 40756095  T
618 gacctgcncctttgagtaaggaaat 642  Q
    || |||| |||||||||||||||||    
40756096 gagctgcacctttgagtaaggaaat 40756120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106238 times since January 2019
Visitors: 1320