View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_55 (Length: 358)

Name: J5_8_55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_55
J5_8_55
[»] chr1 (3 HSPs)
chr1 (115-358)||(48416291-48416534)
chr1 (115-229)||(45174372-45174486)
chr1 (1-43)||(48416530-48416572)
[»] chr2 (3 HSPs)
chr2 (131-336)||(732388-732593)
chr2 (116-220)||(738405-738509)
chr2 (1-43)||(732328-732370)


Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 115 - 358
Target Start/End: Original strand, 48416291 - 48416534
Alignment:
115 caaacctgggtgcatttcagtgatctctgagcaacataattcccaaaaggatcttgaagaacattcaagaaatcatgactactaattatctcctcaacta 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48416291 caaacctgggtgcatttcagtgatctctgagcaacataattcccaaaaggatcttgaagaacattcaagaaatcatgactactaattatctcctcaacta 48416390  T
215 taacttcaacatcatccagtttagagaatgtcaataaattttccnctacattgctggcatacttgttcacagaaagtcttacgaattggccacgaagttc 314  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48416391 taacttcaacatcatccagtttagagaatgtcaataaattttccactacattgctggcatacttgttcacagaaagtcttacgaattggccacgaagttc 48416490  T
315 ttttaccatttgttcatttgctgacgcaaacttcatcataatta 358  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
48416491 ttttaccatttgttcatttgctgacgcaaacttcatcataatta 48416534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 115 - 229
Target Start/End: Complemental strand, 45174486 - 45174372
Alignment:
115 caaacctgggtgcatttcagtgatctctgagcaacataattcccaaaaggatcttgaagaacattcaagaaatcatgactactaattatctcctcaacta 214  Q
    |||||||  |||||||| |||| ||| || || |||||||| ||||| ||||||||||  |||||||||||||||  |||  | ||||||||||||||||    
45174486 caaaccttagtgcatttgagtgctctttgtgccacataatttccaaagggatcttgaacgacattcaagaaatcacaacttttcattatctcctcaacta 45174387  T
215 taacttcaacatcat 229  Q
    ||||  |||||||||    
45174386 taacagcaacatcat 45174372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 48416530 - 48416572
Alignment:
1 aattacacatttcaacacatagtttcttcaaacatacaaaaaa 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
48416530 aattacacatttcaacacatagtttcttcaaacatacaaaaaa 48416572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 131 - 336
Target Start/End: Complemental strand, 732593 - 732388
Alignment:
131 tcagtgatctctgagcaacataattcccaaaaggatcttgaagaacattcaagaaatcatgactactaattatctcctcaactataacttcaacatcatc 230  Q
    |||||| ||| |||||||||||||||||| | ||||| ||||||||||||||||||| | | || || |||||||||||| ||||||||| |||| ||||    
732593 tcagtgctctttgagcaacataattcccatagggatcgtgaagaacattcaagaaattacggcttctcattatctcctcagctataactttaacagcatc 732494  T
231 cagtttagagaatgtcaataaattttccnctacattgctggcatacttgttcacagaaagtcttacgaattggccacgaagttcttttaccatttgttca 330  Q
    | | ||||| ||  ||| || || |||| ||||||||||||||||||||||||||||||||||  | |||| ||  ||||| |||| |||||||||||||    
732493 ctgattagaaaagctcagtagatattccactacattgctggcatacttgttcacagaaagtctatcaaatttgctccgaagctcttgtaccatttgttca 732394  T
331 tttgct 336  Q
    ||||||    
732393 tttgct 732388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 116 - 220
Target Start/End: Complemental strand, 738509 - 738405
Alignment:
116 aaacctgggtgcatttcagtgatctctgagcaacataattcccaaaaggatcttgaagaacattcaagaaatcatgactactaattatctcctcaactat 215  Q
    ||||||| |||||||| |||| ||||| |||||||||||| ||||| ||||| |||||||| |||||||||| | | || || |||||||| ||||| ||    
738509 aaacctgagtgcatttgagtgctctctaagcaacataatttccaaagggatcctgaagaactttcaagaaattacggcttctcattatctcttcaacaat 738410  T
216 aactt 220  Q
    |||||    
738409 aactt 738405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 732370 - 732328
Alignment:
1 aattacacatttcaacacatagtttcttcaaacatacaaaaaa 43  Q
    |||||||| || || ||||||||||||||||||||||||||||    
732370 aattacacgttgcaccacatagtttcttcaaacatacaaaaaa 732328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110439 times since January 2019
Visitors: 1335