View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_56 (Length: 521)

Name: J5_8_56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_56
J5_8_56
[»] chr6 (5 HSPs)
chr6 (45-521)||(17455733-17456209)
chr6 (45-284)||(17434630-17434869)
chr6 (94-189)||(18559537-18559632)
chr6 (1-48)||(17456205-17456252)
chr6 (72-116)||(34212325-34212369)
[»] chr4 (7 HSPs)
chr4 (54-297)||(38221131-38221377)
chr4 (54-298)||(38215092-38215339)
chr4 (50-230)||(38254238-38254418)
chr4 (46-190)||(38239003-38239147)
chr4 (54-294)||(38249127-38249367)
chr4 (54-189)||(38243979-38244114)
chr4 (50-300)||(38227508-38227758)
[»] chr7 (1 HSPs)
chr7 (77-156)||(15912953-15913032)


Alignment Details
Target: chr6 (Bit Score: 465; Significance: 0; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 465; E-Value: 0
Query Start/End: Original strand, 45 - 521
Target Start/End: Original strand, 17455733 - 17456209
Alignment:
45 aattcccagcttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatcc 144  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17455733 aattcccagcttcatcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatcc 17455832  T
145 aggtcttagctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatggtgtgcttaataacaccaca 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17455833 aggtcttagctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatggtgtgcttaataacaccaca 17455932  T
245 ngtatggcaagtgaaagtacaaaatctctaggtacaaacaacatgctgatctgtcagcaatatctttattagtaatgatnaaggaactaattaatgatta 344  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
17455933 agtatggcaagtgaaagtacaaaatctctaggtacaaacaacatgctgatctgtcagcaatatctttattagtaatgattaaggaactaattaatgatta 17456032  T
345 tgaatatattaaacaacagattgtgaaaaatgtactgtgttcataaaatccattgagaattatgcagttaaatgaatataatcatcaaaaggtaaatctt 444  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17456033 tgaatatattaaacaacagattgtgaaaaatgtactgtgttcataaaatccattgagaattatgcagttaaatgaatataatcatcaaaaggtaaatctt 17456132  T
445 gcaaattagtcctcatgaaaagtttttaaagaattgaattatactacaaagtgatcnagattttaaatcacagtcac 521  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
17456133 gcaaattagtcctcatgaaaagtttttaaagaattgaattatactacaaagtgatcaagattttaaatcacagtcac 17456209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 45 - 284
Target Start/End: Original strand, 17434630 - 17434869
Alignment:
45 aattcccagcttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatcc 144  Q
    ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
17434630 aattcccagcttcatcaacaacttctgcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcataataaaatttatttataactgatcc 17434729  T
145 aggtcttagctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatggtgtgcttaataacaccaca 244  Q
     |||| || |||||||||||||||||||||||  |||||||||||  ||||||| ||||||||  | |||||||||||||||||||||||||||| ||||    
17434730 tggtcctaactcaaattttggggacaaaaacatagctgattttattttttcttcagtcttctcaaatgaacttgagcatggtgtgcttaataacaacaca 17434829  T
245 ngtatggcaagtgaaagtacaaaatctctaggtacaaaca 284  Q
     |||| |||||||||||||  |||||||||||||||||||    
17434830 agtattgcaagtgaaagtaagaaatctctaggtacaaaca 17434869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 94 - 189
Target Start/End: Original strand, 18559537 - 18559632
Alignment:
94 atgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtcttagctcaaattttggggacaaaaacactgctgattttat 189  Q
    ||||||| |||||||||||||||||| |||| || |||| |||||||||||||||| || ||||||||| ||||||||||| || |||||||||||    
18559537 atgacctcttggaaaatcaatatcataataatatctattgataactgatccaggtcctaactcaaatttaggggacaaaaatacagctgattttat 18559632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 17456205 - 17456252
Alignment:
1 gtcacatcgtcacacaactaaatttataaagttgatgcagcttcaatt 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
17456205 gtcacatcgtcacacaactaaatttataaagttgatgcagcttcaatt 17456252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 34212325 - 34212369
Alignment:
72 catcaaaactcttgattgctacatgaccttttggaaaatcaatat 116  Q
    ||||||||||||||||| | |||||||| |||||||| |||||||    
34212325 catcaaaactcttgattccaacatgaccctttggaaattcaatat 34212369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 91; Significance: 7e-44; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 54 - 297
Target Start/End: Original strand, 38221131 - 38221377
Alignment:
54 cttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtcttag 153  Q
    |||| ||||| ||||||||||  |||||||||||||||||||||||| |||||||||||||||||| |||| ||||||| |||||||||||||||| |||    
38221131 cttcatcaactacttcagcatggaaactcttgattgctacatgacctcttggaaaatcaatatcataataatatttattgataactgatccaggtcctag 38221230  T
154 ctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatgg---tgtgcttaataacaccacangtatg 250  Q
    ||| ||||| ||||||||||| || |||||||||||| | | ||| || ||| |  |||||| | |||||||   |||||  || |||| |||| ||||     
38221231 ctcgaatttcggggacaaaaatacagctgattttatcttattttcagttttcacaaaagaacctaagcatggtactgtgccaaacaacagcacaagtatt 38221330  T
251 gcaagtgaaagtacaaaatctctaggtacaaacaacatgctgatctg 297  Q
    || | |||||  |||||||||||||||||| || ||||| |||||||    
38221331 gccaatgaaaaaacaaaatctctaggtacacaccacatgttgatctg 38221377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 54 - 298
Target Start/End: Original strand, 38215092 - 38215339
Alignment:
54 cttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtcttag 153  Q
    |||| ||||||||||||||||  |||||||||| ||||||||||||| |||||||||||||||||| |||| || |||| |||||||||||||||| |||    
38215092 cttcatcaacaacttcagcattgaaactcttgagtgctacatgacctcttggaaaatcaatatcataataatatctattgataactgatccaggtcctag 38215191  T
154 ctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgag---catggtgtgcttaataacaccacangtatg 250  Q
    ||| ||||| ||||||||||| || |||||||| ||| | | ||| ||||||    ||||| |||||    |||||||||| || |||| |||| ||||     
38215192 ctcgaatttcggggacaaaaatacagctgatttgatcttattttcagtcttcaaaaaagaagttgagaatgatggtgtgctaaagaacagcacaagtatt 38215291  T
251 gcaagtgaaagtacaaaatctctaggtacaaacaacatgctgatctgt 298  Q
    || ||||||| |||||||| || |  ||||||| ||||| ||||||||    
38215292 gctagtgaaaatacaaaatgtccacatacaaaccacatgttgatctgt 38215339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 50 - 230
Target Start/End: Original strand, 38254238 - 38254418
Alignment:
50 ccagcttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtc 149  Q
    |||| ||| ||||| ||||||||||  |||  ||||||||||| ||| ||| |||||||||||||||||| |||| || |||| | ||||||||||||||    
38254238 ccagattcatcaactacttcagcatggaaatccttgattgctatatggcctcttggaaaatcaatatcataataatatctattgacaactgatccaggtc 38254337  T
150 ttagctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatggtgtgc 230  Q
     |||||||||||| ||||||||||| || |||||||||||| | ||||| |||||| |  |||||||||||||||||||||    
38254338 ctagctcaaatttcggggacaaaaaaacagctgattttatcttatcttcagtcttcacaaaagaacttgagcatggtgtgc 38254418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 46 - 190
Target Start/End: Original strand, 38239003 - 38239147
Alignment:
46 attcccagcttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatcca 145  Q
    |||||| | ||| ||||| ||||||||||  |||||||||| ||||||||||||| |||||||| ||||||||| |||| ||  ||| | ||||||||||    
38239003 attccctgattcgtcaactacttcagcattgaaactcttgagtgctacatgacctcttggaaaaccaatatcataataatatccattgacaactgatcca 38239102  T
146 ggtcttagctcaaattttggggacaaaaacactgctgattttatc 190  Q
    |||| |||||||||||| ||||||||||| || ||||||||||||    
38239103 ggtcctagctcaaatttcggggacaaaaatacagctgattttatc 38239147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 54 - 294
Target Start/End: Original strand, 38249127 - 38249367
Alignment:
54 cttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtcttag 153  Q
    |||| ||||||||||||||||  |||||||||| ||||| |||| |  ||||||||||||||| || ||||||| |||| ||||||||||||||||  ||    
38249127 cttcatcaacaacttcagcattgaaactcttgagtgctatatgatcacttggaaaatcaatataataataaaatctattgataactgatccaggtccaag 38249226  T
154 ctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatggtgtgcttaataacaccacangtatggca 253  Q
     ||||| || ||||||| ||| || |||||||||||  | | ||| ||||||||  |||||||| ||||||||||||  || || |  | | |||| ||     
38249227 ttcaaacttaggggacagaaaaacagctgattttattttattttcagtcttctcaaaagaacttaagcatggtgtgccaaacaataatagaagtattgct 38249326  T
254 agtgaaagtacaaaatctctaggtacaaacaacatgctgat 294  Q
    | ||| | | |||||||||||||||||||| ||||| ||||    
38249327 actgacaattcaaaatctctaggtacaaaccacatgttgat 38249367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 54 - 189
Target Start/End: Original strand, 38243979 - 38244114
Alignment:
54 cttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtcttag 153  Q
    |||| ||||| ||||||||||  |||||||||| ||| | ||||||| |||||||||||||||||| |||   |||||| |||||||||||||||| ||     
38243979 cttcatcaactacttcagcattgaaactcttgagtgcaatatgacctcttggaaaatcaatatcataatattctttattgataactgatccaggtcctaa 38244078  T
154 ctcaaattttggggacaaaaacactgctgattttat 189  Q
    ||| ||||||||||||||||| || |||||||||||    
38244079 ctcgaattttggggacaaaaatacagctgattttat 38244114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 50 - 300
Target Start/End: Original strand, 38227508 - 38227758
Alignment:
50 ccagcttcntcaacaacttcagcatcaaaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtc 149  Q
    ||||| || ||||| ||||||||||  |||||||| | ||||| ||| ||| |||||||||||||||||| ||||  |||||| ||||||||||||||||    
38227508 ccagcatcatcaactacttcagcattgaaactctttagtgctatatgccctcttggaaaatcaatatcataataatgtttattgataactgatccaggtc 38227607  T
150 ttagctcaaattttggggacaaaaacactgctgattttatcctttcttcggtcttctcgtaagaacttgagcatggtgtgcttaataacaccacangtat 249  Q
      || ||||| || ||||||| ||| || |||||||| ||  | ||||||| |||| |  | ||||||||||||| ||| |  || || |  | | ||||    
38227608 caagttcaaacttaggggacagaaaaacagctgatttgattttatcttcggccttcacaaaggaacttgagcatgttgtaccaaacaatagtagaagtat 38227707  T
250 ggcaagtgaaagtacaaaatctctaggtacaaacaacatgctgatctgtca 300  Q
     ||   | ||| |||||||||||||| ||||||  ||||||||||||||||    
38227708 tgcctctaaaaatacaaaatctctagatacaaaacacatgctgatctgtca 38227758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 15913032 - 15912953
Alignment:
77 aaactcttgattgctacatgaccttttggaaaatcaatatcatcataaaatttatttataactgatccaggtcttagctc 156  Q
    |||||||||| |||||  |||||| ||||||||||||||| ||  ||| || | ||||||||||||||||||| ||||||    
15913032 aaactcttgagtgctatgtgacctcttggaaaatcaatattatattaatatctttttataactgatccaggtcctagctc 15912953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108116 times since January 2019
Visitors: 1329