View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_61 (Length: 398)

Name: J5_8_61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_61
J5_8_61
[»] chr1 (14 HSPs)
chr1 (241-398)||(26033354-26033511)
chr1 (40-144)||(2024761-2024865)
chr1 (40-144)||(38982857-38982961)
chr1 (40-144)||(18411960-18412062)
chr1 (40-144)||(28644099-28644201)
chr1 (40-144)||(32522289-32522391)
chr1 (40-144)||(2842127-2842231)
chr1 (50-144)||(41401918-41402012)
chr1 (40-144)||(45538775-45538877)
chr1 (40-144)||(43641481-43641585)
chr1 (1-44)||(26033315-26033358)
chr1 (103-144)||(24777193-24777234)
chr1 (141-182)||(26033570-26033611)
chr1 (40-83)||(24777235-24777278)
[»] chr3 (6 HSPs)
chr3 (40-144)||(47332725-47332829)
chr3 (40-144)||(33954215-33954319)
chr3 (40-131)||(22399729-22399820)
chr3 (85-144)||(28416711-28416770)
chr3 (85-144)||(4065049-4065108)
chr3 (85-144)||(37966536-37966595)
[»] chr8 (4 HSPs)
chr8 (40-144)||(12500020-12500124)
chr8 (40-144)||(39620409-39620513)
chr8 (40-144)||(6418317-6418419)
chr8 (40-144)||(18383918-18384020)
[»] chr7 (5 HSPs)
chr7 (40-144)||(46806507-46806611)
chr7 (40-144)||(34642116-34642218)
chr7 (40-144)||(42051043-42051145)
chr7 (40-144)||(21952475-21952579)
chr7 (85-144)||(6614390-6614449)
[»] chr5 (8 HSPs)
chr5 (40-144)||(22495293-22495397)
chr5 (40-144)||(1597018-1597122)
chr5 (40-144)||(5810850-5810954)
chr5 (40-144)||(40832012-40832116)
chr5 (40-144)||(16479914-16480016)
chr5 (104-144)||(39563575-39563615)
chr5 (40-92)||(39563532-39563584)
chr5 (40-83)||(22832967-22833010)
[»] chr4 (5 HSPs)
chr4 (40-144)||(27022935-27023039)
chr4 (40-144)||(34803586-34803690)
chr4 (40-144)||(5945600-5945702)
chr4 (40-144)||(36318875-36318979)
chr4 (40-144)||(36333084-36333188)
[»] chr2 (2 HSPs)
chr2 (40-144)||(40265130-40265234)
chr2 (52-144)||(4649759-4649851)
[»] chr6 (3 HSPs)
chr6 (40-144)||(19422308-19422412)
chr6 (40-144)||(22512007-22512111)
chr6 (40-144)||(18901448-18901550)
[»] scaffold0009 (1 HSPs)
scaffold0009 (40-144)||(197215-197317)


Alignment Details
Target: chr1 (Bit Score: 158; Significance: 6e-84; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 241 - 398
Target Start/End: Complemental strand, 26033511 - 26033354
Alignment:
241 gcagacagctttggagacactttttaattacttctctcatcgagaactggtgcttttctatccaacttaatgagaacctcttcatctttaccaaatcatt 340  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033511 gcagacagctttggagacactttttaattacttctctcatcgagaactggtgcttttctatccaacttaatgagaacctcttcatctttaccaaatcatt 26033412  T
341 aacagtgaacaacttcatcttccatggtttcaaaaactttgactcaaaagctaatctt 398  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033411 aacagtgaacaacttcatcttccatggtttcaaaaactttgactcaaaagctaatctt 26033354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 2024865 - 2024761
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
2024865 gaattctttagtagcatatgacataatactctaaagtggttggaattattgtgatcttccaattaattattgtgagggtactcttcatttcagtggttct 2024766  T
140 caatt 144  Q
    |||||    
2024765 caatt 2024761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 38982857 - 38982961
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38982857 gaattcttttgcagcatatgacataatattctaaagtggttgaaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 38982956  T
140 caatt 144  Q
    |||||    
38982957 caatt 38982961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 18412062 - 18411960
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
18412062 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 18411965  T
140 caatt 144  Q
    |||||    
18411964 caatt 18411960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 28644099 - 28644201
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
28644099 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 28644196  T
140 caatt 144  Q
    |||||    
28644197 caatt 28644201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 32522289 - 32522391
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
32522289 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 32522386  T
140 caatt 144  Q
    |||||    
32522387 caatt 32522391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 2842231 - 2842127
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| | |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||||||||    
2842231 gaattcttttgcagcatatgacataatattctaaagtggttgaaattattgcgttcttccaattaattattgtgagtgtactcttcatttcagtggttct 2842132  T
140 caatt 144  Q
    |||||    
2842131 caatt 2842127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 50 - 144
Target Start/End: Original strand, 41401918 - 41402012
Alignment:
50 gtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||    
41401918 gtagcatatgacataatattataaagtgattggaattattgtgttcttccaattaattattgtgagagtactcttcatttcaatggttctcaatt 41402012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 45538877 - 45538775
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    |||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||  ||||||    
45538877 gaattctttagtagcatatgacataatactctaaagtggttgaaattattgtgatcttccaattaattattgtgaggatactcttcatttca--ggttct 45538780  T
140 caatt 144  Q
    |||||    
45538779 caatt 45538775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 43641481 - 43641585
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||||||||||||||||||||||||||| ||  |||||||||||||||   |||||||||||||| ||||||||||||||||||||||||    
43641481 gaattctttggtagcatatgacataatattctaaagtgtttataattattgtgttcttttcattaattattgtgatggtactcttcatttcagtggttct 43641580  T
140 caatt 144  Q
    |||||    
43641581 caatt 43641585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 26033358 - 26033315
Alignment:
1 atcttcacacctgttcaccgctctcagaaaccaaacaacgaatt 44  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
26033358 atcttcacacctgttcaccgctctcagaaaccaaacaacgaatt 26033315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 103 - 144
Target Start/End: Complemental strand, 24777234 - 24777193
Alignment:
103 taattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    ||||||||||||||||||||||||||||||||||||||||||    
24777234 taattattgtgagggtactcttcatttcagtggttctcaatt 24777193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 141 - 182
Target Start/End: Complemental strand, 26033611 - 26033570
Alignment:
141 aattcagtacatgaagaggtatacagagtcggttcgcttgtc 182  Q
    ||||||||||||||||||||||||||||||||||||||||||    
26033611 aattcagtacatgaagaggtatacagagtcggttcgcttgtc 26033570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 40 - 83
Target Start/End: Complemental strand, 24777278 - 24777235
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttgga 83  Q
    ||||||||| ||||||||||||||||||||||||||||||||||    
24777278 gaattctttggtagcatatgacataatattctaaagtggttgga 24777235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 47332725 - 47332829
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47332725 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 47332824  T
140 caatt 144  Q
    |||||    
47332825 caatt 47332829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 33954215 - 33954319
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
33954215 gaattctatagtagcatatgacataatactctaaagtggttggaattattgtgttcttccaattaattattgtgatggtactcttcatttcagtggttct 33954314  T
140 caatt 144  Q
    |||||    
33954315 caatt 33954319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 40 - 131
Target Start/End: Complemental strand, 22399820 - 22399729
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttca 131  Q
    |||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||    
22399820 gaattctttagtagcatatgacataatactctaaagtggttgaaattattgtgatcttccaattaattattgtgaggatactcttcatttca 22399729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 85 - 144
Target Start/End: Original strand, 28416711 - 28416770
Alignment:
85 ttattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
28416711 ttattgtgatcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 28416770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 85 - 144
Target Start/End: Original strand, 4065049 - 4065108
Alignment:
85 ttattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
4065049 ttattgtgatcttccaattaattattgtgagggtactcttcatttcagcggttctcaatt 4065108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 85 - 144
Target Start/End: Complemental strand, 37966595 - 37966536
Alignment:
85 ttattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
37966595 ttattgtgatcttccaattaattattgtgagggtactcttcatttcagcggttctcaatt 37966536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 12500020 - 12500124
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
12500020 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttctttcaattaattattgtgagggtactcttcatttcagtggttct 12500119  T
140 caatt 144  Q
    |||||    
12500120 caatt 12500124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 39620409 - 39620513
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
39620409 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtcagggtactcttcatttcagtggttct 39620508  T
140 caatt 144  Q
    |||||    
39620509 caatt 39620513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 6418419 - 6418317
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
6418419 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 6418322  T
140 caatt 144  Q
    |||||    
6418321 caatt 6418317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 18383918 - 18384020
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
18383918 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 18384015  T
140 caatt 144  Q
    |||||    
18384016 caatt 18384020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 46806611 - 46806507
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
46806611 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtcagggtactcttcatttcagtggttct 46806512  T
140 caatt 144  Q
    |||||    
46806511 caatt 46806507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 34642116 - 34642218
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||    
34642116 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttaagtggttct 34642213  T
140 caatt 144  Q
    |||||    
34642214 caatt 34642218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 42051145 - 42051043
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
42051145 gaattctttggtagaatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 42051048  T
140 caatt 144  Q
    |||||    
42051047 caatt 42051043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 21952475 - 21952579
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||    
21952475 gaattctttggtagcatatgacataatattctaaagtggtttgaattattatgttcttccaattaattattgtgagtgtactattcatttcagtggttct 21952574  T
140 caatt 144  Q
    |||||    
21952575 caatt 21952579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 85 - 144
Target Start/End: Complemental strand, 6614449 - 6614390
Alignment:
85 ttattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
6614449 ttattgtgatcttccaattaattattgtgagggtactcttcatttcagcggttctcaatt 6614390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 97; Significance: 1e-47; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 22495293 - 22495397
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22495293 gaattctttggtagcatatgacataatattataaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 22495392  T
140 caatt 144  Q
    |||||    
22495393 caatt 22495397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 1597018 - 1597122
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||    
1597018 gaattctttagtagcatatgacataatactctaaagtggttggaattattgtgatctttcaattaattattgtgagggtactcttcatttcagtggttct 1597117  T
140 caatt 144  Q
    |||||    
1597118 caatt 1597122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 5810850 - 5810954
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
5810850 gaattctttggtagcatatgacataatattctaaagtggttgaaattattgtgttcttccaattaattattgtcagggtactcttcatttcagtggttct 5810949  T
140 caatt 144  Q
    |||||    
5810950 caatt 5810954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 40832116 - 40832012
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||    
40832116 gaattctttagtagcatatgacataatactctaaagtggttggaattattgcgatcttccaattaattattgtgagggtactcttcatttcagtggttct 40832017  T
140 caatt 144  Q
    |||||    
40832016 caatt 40832012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 16480016 - 16479914
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
16480016 gaattctttggtagaatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 16479919  T
140 caatt 144  Q
    |||||    
16479918 caatt 16479914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 104 - 144
Target Start/End: Original strand, 39563575 - 39563615
Alignment:
104 aattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||||||||||||||||||||||||||||||||||||    
39563575 aattattgtgagggtactcttcatttcagtggttctcaatt 39563615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 40 - 92
Target Start/End: Original strand, 39563532 - 39563584
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtg 92  Q
    |||||||||||||||||||| ||||||| |||||||| |||| ||||||||||    
39563532 gaattctttagtagcatatgccataatactctaaagtagttgaaattattgtg 39563584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 40 - 83
Target Start/End: Original strand, 22832967 - 22833010
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttgga 83  Q
    ||||| ||| |||||||||||||||||||| |||||||||||||    
22832967 gaattatttggtagcatatgacataatattttaaagtggttgga 22833010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 27022935 - 27023039
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
27022935 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttctttcaattaattattgtgagggtactcttcatttcagtggttct 27023034  T
140 caatt 144  Q
    |||||    
27023035 caatt 27023039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 34803690 - 34803586
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
34803690 gaattctttggaagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagtgtactcttcatttcagtggttct 34803591  T
140 caatt 144  Q
    |||||    
34803590 caatt 34803586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 5945702 - 5945600
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
5945702 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 5945605  T
140 caatt 144  Q
    |||||    
5945604 caatt 5945600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 36318875 - 36318979
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
36318875 gaattctttggtagcatatgacataatattctaaagtcgttggaattattgtgttcttccaattaattattctgagggtactcttcatttcagtggttct 36318974  T
140 caatt 144  Q
     ||||    
36318975 aaatt 36318979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 36333084 - 36333188
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
36333084 gaattctttggtagcatatgacataatattctaaagtcgttggaattattgtgttcttccaattaattattctgagggtactcttcatttcagtggttct 36333183  T
140 caatt 144  Q
     ||||    
36333184 aaatt 36333188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 40265234 - 40265130
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
40265234 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttctttcaattaattattgtgagggtactcttcatttcagtggttct 40265135  T
140 caatt 144  Q
    |||||    
40265134 caatt 40265130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 52 - 144
Target Start/End: Original strand, 4649759 - 4649851
Alignment:
52 agcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttctcaatt 144  Q
    |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||    
4649759 agcatatgacataatattctaaagtggttgaaattattgcgttcttccaattaattattgtgagtgtactcttcatttcagtggttctcaatt 4649851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 93; Significance: 4e-45; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 19422412 - 19422308
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
19422412 gaattctttggtagcatatgacataatattctaaagtagttggaattattgtgttctttcaattaattattgtgagggtactcttcatttcagtggttct 19422313  T
140 caatt 144  Q
    |||||    
19422312 caatt 19422308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 22512111 - 22512007
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
22512111 gaattctttggtagcatattacataatattctaaagtggttggaattattgtgttcttcccattaattattgtgagggtactcttcatttcagtggttct 22512012  T
140 caatt 144  Q
    |||||    
22512011 caatt 22512007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 18901448 - 18901550
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
18901448 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 18901545  T
140 caatt 144  Q
    |||||    
18901546 caatt 18901550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 197215 - 197317
Alignment:
40 gaattctttagtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattattgtgagggtactcttcatttcagtggttct 139  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
197215 gaattctttggtagcatatgacataatattctaaagtggttggaattattgtgttcttccaattaattat--tgagggtactcttcatttcagtggttct 197312  T
140 caatt 144  Q
    |||||    
197313 caatt 197317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105790 times since January 2019
Visitors: 1319