View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_67 (Length: 333)

Name: J5_8_67
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_67
J5_8_67
[»] chr5 (14 HSPs)
chr5 (59-333)||(25726261-25726534)
chr5 (59-295)||(25226635-25226867)
chr5 (59-295)||(25290791-25291024)
chr5 (1-62)||(25726204-25726265)
chr5 (1-58)||(25183602-25183659)
chr5 (197-266)||(25183386-25183455)
chr5 (1-56)||(25226946-25227001)
chr5 (1-56)||(25291103-25291158)
chr5 (3-48)||(25092886-25092931)
chr5 (3-48)||(25150856-25150901)
chr5 (101-153)||(14396949-14397001)
chr5 (293-333)||(25226910-25226950)
chr5 (293-333)||(25291067-25291107)
chr5 (293-333)||(25183566-25183606)


Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 14)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 59 - 333
Target Start/End: Complemental strand, 25726534 - 25726261
Alignment:
59 aattctgttgcacttactttgtttgttatttcagtttgcttttgggttggtttttatccctgaagtcttcacttttagcttgcacaaatgcctttgggct 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25726534 aattctgttgcacttactttgtttgttatttcagtttgcttttgggttggtttttatccctgaagtcttcacttttagcttgcacaaatgcctttgggct 25726435  T
159 tgtaatcattggatgtagattctttgnnnnnnnnnnnccttgaatcttctttctgctatattactcatatcagtcaataaaatagaaattttatatgacc 258  Q
    ||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25726434 tgtaatcattggatgtagattctttgtttttttttt-ccttgaatcttctttctgctatattactcatatcagtcaataaaatagaaattttatatgacc 25726336  T
259 attttttggacatttaacacaactatagatttgtatcccgtttcatatgttaccagcttgtgccttccactcaaa 333  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25726335 attttttggacatttaacacaactatagatttgtatcccgtttcatatgttaccagcttgtgccttccactcaaa 25726261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 59 - 295
Target Start/End: Original strand, 25226635 - 25226867
Alignment:
59 aattctgttgcacttactttgtttgttatttcagtttgcttttgggttggtttttatccctgaagtcttcacttttagcttgcacaaatgcctttgggct 158  Q
    |||||||||| |||  ||||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||| |||||||||||||||    
25226635 aattctgttggactccctttgttggttatttcagtttgcttttgggttggtttttatccctcaagtctttactttcagcttgcataaatgcctttgggct 25226734  T
159 tgtaatcattggatgtagattctttgnnnnnnnnnnnccttgaatcttctttctgctatattactcatatcagtcaataaaatagaaattttatatgacc 258  Q
    ||||||||||||| ||| ||||||||            ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||    
25226735 tgtaatcattggaagtatattctttgtttttttt----cttgaatcttctttctgttatattactcatatcagtcaataaaaaagaaattttatatggcc 25226830  T
259 attttttggacatttaacacaactatagatttgtatc 295  Q
    | |||||| ||| | || | |||||||||||||||||    
25226831 actttttgaacaatcaaaataactatagatttgtatc 25226867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 59 - 295
Target Start/End: Original strand, 25290791 - 25291024
Alignment:
59 aattctgttgcacttactttgtttgttatttcagtttgcttttgggttggtttttatccctgaagtcttcacttttagcttgcacaaatgcctttgggct 158  Q
    |||||||||| |||  ||||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||| |||||||||||||||    
25290791 aattctgttggactccctttgttggttatttcagtttgcttttgggttggtttttatccctcaagtctttactttcagcttgcataaatgcctttgggct 25290890  T
159 tgtaatcattggatgtagattctttgnnnnnnnnnnnccttgaatcttctttctgctatattactcatatcagtcaataaaatagaaattttatatgacc 258  Q
    ||||||||||||| ||| ||||||||            ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||    
25290891 tgtaatcattggaagtatattctttgttttttttt---cttgaatcttctttctgttatattactcatatcagtcaataaaaaagaaattttatatggcc 25290987  T
259 attttttggacatttaacacaactatagatttgtatc 295  Q
    | |||||| ||| | || | |||||||||||||||||    
25290988 actttttgaacaatcaaaataactatagatttgtatc 25291024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 25726265 - 25726204
Alignment:
1 tcaaatacaaatgagtttagaaactcggtttgaacttgaaatttaaatcattgttgcgaatt 62  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25726265 tcaaatacaaatgagtttagaaactcggtttgaacttgaaatttaaatcattgttgcgaatt 25726204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 25183602 - 25183659
Alignment:
1 tcaaatacaaatgagtttagaaactcggtttgaacttgaaatttaaatcattgttgcg 58  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
25183602 tcaaatacaaatgagtttagaaactcggtttgaacttgaaatttaactcattgttgcg 25183659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 197 - 266
Target Start/End: Original strand, 25183386 - 25183455
Alignment:
197 cttgaatcttctttctgctatattactcatatcagtcaataaaatagaaattttatatgaccattttttg 266  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||| ||||| ||||||    
25183386 cttgaatcttcattctgttatattactcatatcagtcaataaaatagaaatttcataagaccactttttg 25183455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 25226946 - 25227001
Alignment:
1 tcaaatacaaatgagtttagaaactcggtttgaacttgaaatttaaatcattgttg 56  Q
    ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||    
25226946 tcaaatacaaatgagtttagaaactcgatttaaacttgaaatttaaatcattgttg 25227001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 25291103 - 25291158
Alignment:
1 tcaaatacaaatgagtttagaaactcggtttgaacttgaaatttaaatcattgttg 56  Q
    ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||    
25291103 tcaaatacaaatgagtttagaaactcgatttaaacttgaaatttaaatcattgttg 25291158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 25092886 - 25092931
Alignment:
3 aaatacaaatgagtttagaaactcggtttgaacttgaaatttaaat 48  Q
    |||||||||||| ||||||||||| |||||||||||||||||||||    
25092886 aaatacaaatgactttagaaactcagtttgaacttgaaatttaaat 25092931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 25150856 - 25150901
Alignment:
3 aaatacaaatgagtttagaaactcggtttgaacttgaaatttaaat 48  Q
    |||||||||||| ||||||||||| |||||||||||||||||||||    
25150856 aaatacaaatgactttagaaactcagtttgaacttgaaatttaaat 25150901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 101 - 153
Target Start/End: Complemental strand, 14397001 - 14396949
Alignment:
101 tgggttggtttttatccctgaagtcttcacttttagcttgcacaaatgccttt 153  Q
    ||||||||||||||||||| ||||||||||||| |||||||| |||| |||||    
14397001 tgggttggtttttatcccttaagtcttcactttcagcttgcataaataccttt 14396949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 293 - 333
Target Start/End: Original strand, 25226910 - 25226950
Alignment:
293 atcccgtttcatatgttaccagcttgtgccttccactcaaa 333  Q
    |||| |||||||||||| |||||||||||||||||||||||    
25226910 atcctgtttcatatgttcccagcttgtgccttccactcaaa 25226950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 293 - 333
Target Start/End: Original strand, 25291067 - 25291107
Alignment:
293 atcccgtttcatatgttaccagcttgtgccttccactcaaa 333  Q
    |||| |||||||||||| |||||||||||||||||||||||    
25291067 atcctgtttcatatgttcccagcttgtgccttccactcaaa 25291107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 293 - 333
Target Start/End: Original strand, 25183566 - 25183606
Alignment:
293 atcccgtttcatatgttaccagcttgtgccttccactcaaa 333  Q
    |||||||||||||  |||||||||||||| |||||||||||    
25183566 atcccgtttcataaattaccagcttgtgcattccactcaaa 25183606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360955 times since January 2019
Visitors: 487