View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_7 (Length: 238)

Name: J5_8_7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_7
J5_8_7
[»] chr3 (3 HSPs)
chr3 (1-70)||(35986290-35986359)
chr3 (132-178)||(35986135-35986181)
chr3 (196-228)||(35986253-35986285)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 35986290 - 35986359
Alignment:
1 cacttcactagaagaaaatagaagtgtctagtatctattttatgtttctttttcgtagtaaaaattatta 70  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
35986290 cacttcactagaagaaaatagaagtgtctagtatatattttatgtttctttttcgtagtaaaaattatta 35986359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 35986135 - 35986181
Alignment:
132 aaattaattcntcatattttgcgggattcaaatnaacggaancaaat 178  Q
    |||||||||| |||||||||| ||||||||||| ||||||| |||||    
35986135 aaattaattcttcatattttgtgggattcaaataaacggaatcaaat 35986181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 228
Target Start/End: Original strand, 35986253 - 35986285
Alignment:
196 aagaaaaaaccacttttttagcaatctaaattc 228  Q
    |||||||||||||||||||||||||| ||||||    
35986253 aagaaaaaaccacttttttagcaatccaaattc 35986285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108379 times since January 2019
Visitors: 1329