View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_76 (Length: 530)

Name: J5_8_76
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_76
J5_8_76
[»] chr1 (3 HSPs)
chr1 (1-276)||(26033083-26033358)
chr1 (373-530)||(26033354-26033511)
chr1 (273-314)||(26033570-26033611)


Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 26033358 - 26033083
Alignment:
1 atcttcacacctgttcaccgctctcagaaaccaaacaacgaatttgcacgaaccaagtatgaaaaaatattgtgaatcggtacgtgcgaaccggttcgtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033358 atcttcacacctgttcaccgctctcagaaaccaaacaacgaatttgcacgaaccaagtatgaaaaaatattgtgaatcggtacgtgcgaaccggttcgtg 26033259  T
101 gttctcagggggaagtggcgaattatgtaattatgttcctaacattatataaaaaatagatcatttataactatcgatgtgattatgaggaaaaaacaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033258 gttctcagggggaagtggcgaattatgtaattatgttcctaacattatataaaaaatagatcatttataactatcgatgtgattatgaggaaaaaacaac 26033159  T
201 tgatgaaaagataataattatgataatttgcattatgcatcaacaaactgtgaggagattgagtttcatagcaatt 276  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033158 tgatgaaaagataataattatgataatttgcattatgcatcaacaaactgtgaggagattgagtttcatagcaatt 26033083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 373 - 530
Target Start/End: Complemental strand, 26033511 - 26033354
Alignment:
373 gcagacagctttggagacactttttaattacttctctcatcgagaactggtgcttttctatccaacttaatgagaacctcttcatctttaccaaatcatt 472  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033511 gcagacagctttggagacactttttaattacttctctcatcgagaactggtgcttttctatccaacttaatgagaacctcttcatctttaccaaatcatt 26033412  T
473 aacagtgaacaacttcatcttccatggtttcaaaaactttgactcaaaagctaatctt 530  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033411 aacagtgaacaacttcatcttccatggtttcaaaaactttgactcaaaagctaatctt 26033354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 273 - 314
Target Start/End: Complemental strand, 26033611 - 26033570
Alignment:
273 aattcagtacatgaagaggtatacagagtcggttcgcttgtc 314  Q
    ||||||||||||||||||||||||||||||||||||||||||    
26033611 aattcagtacatgaagaggtatacagagtcggttcgcttgtc 26033570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105792 times since January 2019
Visitors: 1319