View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_85 (Length: 705)

Name: J5_8_85
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_85
J5_8_85
[»] chr3 (24 HSPs)
chr3 (1-629)||(26117463-26118095)
chr3 (1-629)||(26239727-26240359)
chr3 (96-592)||(26145562-26146052)
chr3 (95-420)||(26212608-26212933)
chr3 (97-420)||(26184003-26184326)
chr3 (102-422)||(18081556-18081876)
chr3 (102-386)||(27343460-27343744)
chr3 (95-386)||(27369758-27370049)
chr3 (102-383)||(18723685-18723966)
chr3 (280-357)||(28129462-28129539)
chr3 (280-357)||(28143390-28143467)
chr3 (283-357)||(28513865-28513939)
chr3 (280-357)||(27909310-27909387)
chr3 (280-357)||(28472843-28472920)
chr3 (283-357)||(28492887-28492961)
chr3 (280-357)||(28078916-28078993)
chr3 (516-592)||(18081991-18082067)
chr3 (307-357)||(17749881-17749931)
chr3 (307-357)||(19051201-19051251)
chr3 (440-490)||(26212965-26213015)
chr3 (280-357)||(11408306-11408383)
chr3 (514-543)||(26213033-26213062)
chr3 (280-357)||(28046943-28047020)
chr3 (280-357)||(28177545-28177622)
[»] scaffold1344 (1 HSPs)
scaffold1344 (102-422)||(111-431)
[»] scaffold0854 (1 HSPs)
scaffold0854 (102-422)||(4740-5060)
[»] scaffold0043 (1 HSPs)
scaffold0043 (95-422)||(73502-73829)
[»] chr4 (2 HSPs)
chr4 (280-357)||(9330780-9330857)
chr4 (280-357)||(9384563-9384640)
[»] chr7 (1 HSPs)
chr7 (282-357)||(8695210-8695285)


Alignment Details
Target: chr3 (Bit Score: 593; Significance: 0; HSPs: 24)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 593; E-Value: 0
Query Start/End: Original strand, 1 - 629
Target Start/End: Original strand, 26117463 - 26118095
Alignment:
1 ttcatcacatacttatatgttgcttctgataaatgatttctttttaaagccacaccttttgtttttggccaattccaattatcataattatccatgagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26117463 ttcatcacatacttatatgttgcttctgataaatgatttctttttaaagccacaccttttgtttttggccaattccaattatcataattatccatgagaa 26117562  T
101 aatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26117563 aatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttc 26117662  T
201 aaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26117663 aaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataa 26117762  T
301 agcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaataact 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26117763 agcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaataact 26117862  T
401 gaattgattttggtaatgataggtgggtatttgatagtttcaaaattcgaagccctaccatattttcaaagagtgaagtggggacatcctcagaatcatc 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26117863 gaattgattttggtaatgataggtgggtatttgatagtttcaaaattcgaagccctaccatattttcaaagagtgaagtggggacatcctcagaatcatc 26117962  T
501 catggacgtgttcgcaattagaatctcaagcttagagccatcaaacccagaggaatataaatccattagatttccttggaagaacaaata-ttgata-tc 598  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||    
26117963 catggacgtgtttgcaattagaatctcaagcttagagccatcaaacccagaggaatataaatccattagatttccttggaagaacaaatatttgatattc 26118062  T
599 ctactcctatc-accaatgac-tttgatttttt 629  Q
     |||||||||| ||||||||| |||||||||||    
26118063 ttactcctatcaaccaatgacttttgatttttt 26118095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 1 - 629
Target Start/End: Original strand, 26239727 - 26240359
Alignment:
1 ttcatcacatacttatatgttgcttctgataaatgatttctttttaaagccacaccttttgtttttggccaattccaattatcataattatccatgagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||| |||||||||  | |||||||  ||||||    
26239727 ttcatcacatacttatatgttgcttctgataaatgatttctttctaaagccacactttttgtttctggccatttccaattacgagaattatcagtgagaa 26239826  T
101 aatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttc 200  Q
    ||||||||||||||||||||||||||||||||| |||||| ||||||||||| | ||  |||||||||||||| | ||||||||||||||||||||||||    
26239827 aatacctttccaatgtaggtaaggttatttccttacaaaactcattgaaactataactaaagtacaattcttcaagtgatgggcatctctggataacttc 26239926  T
201 aaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataa 300  Q
    |||||||||||||||| |||||  ||||||| ||||   ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||    
26239927 aaatggattattgcttctaattttacaatctctcaatgacaacagtctaagtttcttcaacattgcaatttcaggggaaaattcataaatttcacaataa 26240026  T
301 agcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaataact 400  Q
      ||||||||||| |||||||||||||||| |||| |||| ||||||||||||||||   |||  |||||||||||||||||||||||||||||||||||    
26240027 tccaattcaagagtttcaagactttgcaggcttccaaaaatagagatgtcacccaaaatgacacattcaactgatagagaacgaatgttgatcaataact 26240126  T
401 gaattgattttggtaatgataggtgggtatttgatagtttcaaaattcgaagccctaccatattttcaaagagtgaagtggggacatcctcagaatcatc 500  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||    
26240127 gaattgattttggtaatgatagaggggtatttgatagtttcaaaattcgaagccctgccatattttcaaaaagtgaagtggggacatccttagaatcatc 26240226  T
501 catggacgtgttcgcaattagaatctcaagcttagagccatcaaacccagaggaatataaatccattagatttccttggaagaacaaata-ttgata-tc 598  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||| ||    
26240227 catggacgtgtttgcaattagaatctcaagcttagagccatcaaaccaagaggaacataaatccattagatttccttggaagaacaaatatttgatattc 26240326  T
599 ctactcctatc-accaatgac-tttgatttttt 629  Q
     ||||||| || ||||||||| |||||||||||    
26240327 ttactcctttcaaccaatgacttttgatttttt 26240359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 96 - 592
Target Start/End: Original strand, 26145562 - 26146052
Alignment:
96 gagaaaatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggata 195  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| | |||||||||||| ||||||    
26145562 gagaagatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactatgactgaagtacaattcttcaagtgatgggcatctatggata 26145661  T
196 acttcaaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttac 295  Q
    ||||||||||||||||||||| |||||  |||   | |||||  ||||| |||||| || |||||||||||||||||||||||||||||||||||||| |    
26145662 acttcaaatggattattgcttctaatttgacaccatctcaagctcaacaatctaaggttattcaacattgcaatttcaggggaaaattcatcaattttgc 26145761  T
296 aataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaa 395  Q
    || || ||||||||||||  |||||||||||||| |||||||||| ||||||||||||||||   |||||||||| | |||||||||| |||||   |||    
26145762 aagaatgcaattcaagagtctcaagactttgcagtgttcccaaaatagagatgtcacccaaattgacattttcaattaatagagaacggatgttctccaa 26145861  T
396 taactgaattgattttggtaatgataggtgggtatttgatagtttcaaaattcgaagccctaccatattttcaaagagtgaagtggggacatcctcagaa 495  Q
    |||||||||||||||||||||||||||      || ||||| || |||||||||||||||| ||||||||||| ||| ||||||| ||||||||||| |     
26145862 taactgaattgattttggtaatgatag------atgtgataattgcaaaattcgaagccctgccatattttcagagaatgaagtgcggacatcctcaaac 26145955  T
496 tcatccatggacgtgttcgcaattagaatctcaagcttagagccatcaaacccagaggaatataaatccattagatttccttggaagaacaaatatt 592  Q
     ||||||||||  | || ||||||| |||||||||||||||  ||||||||| || |||| ||||||||||||| ||||||||||||||||||||||    
26145956 gcatccatggatttttttgcaattaaaatctcaagcttagatgcatcaaacctagtggaaaataaatccattagttttccttggaagaacaaatatt 26146052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 170; E-Value: 7e-91
Query Start/End: Original strand, 95 - 420
Target Start/End: Original strand, 26212608 - 26212933
Alignment:
95 tgagaaaatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggat 194  Q
    |||||| ||||||||||||| |||||||||||||||| | |||| | | ||||||||| |   |||||||||||||||| | ||||||||| ||||||||    
26212608 tgagaacatacctttccaatctaggtaaggttatttctttacaagatttattgaaactcttcaagaagtacaattcttcaagtgatgggcaactctggat 26212707  T
195 aacttcaaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaatttta 294  Q
    ||||||||||||||||||| || ||||| |||| ||| |||||  ||||| |||||||||||||||| ||||||||||| |||||||||||||||||| |    
26212708 aacttcaaatggattattgtttttaatttcacattctttcaagcacaacaatctaagtttcttcaactttgcaatttcacgggaaaattcatcaatttca 26212807  T
295 caataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatca 394  Q
    |||||| ||||||||||||  ||||||||||||||| ||||||||||||||||||| ||||||   || ||||||||||||||||||||||| |||||||    
26212808 caataatgcaattcaagagtctcaagactttgcaggcttcccaaaacagagatgtcccccaaaatgactttttcaactgatagagaacgaatattgatca 26212907  T
395 ataactgaattgattttggtaatgat 420  Q
     ||||| |||||| |||| |||||||    
26212908 ttaacttaattgaatttgctaatgat 26212933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 164; E-Value: 3e-87
Query Start/End: Original strand, 97 - 420
Target Start/End: Original strand, 26184003 - 26184326
Alignment:
97 agaaaatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataa 196  Q
    |||| ||||||||||||| |||||||||||||||| | |||| | | ||||||||| |   |||||||||||||||| | ||||||||| ||||||||||    
26184003 agaacatacctttccaatctaggtaaggttatttctttacaagatttattgaaactcttcaagaagtacaattcttcaagtgatgggcaactctggataa 26184102  T
197 cttcaaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttaca 296  Q
    ||||||||||||||||| || ||||| |||| ||| |||||  ||||| |||||||||||||||| ||||||||||| |||||||||||||||||| |||    
26184103 cttcaaatggattattgtttttaatttcacattctttcaagcacaacaatctaagtttcttcaactttgcaatttcacgggaaaattcatcaatttcaca 26184202  T
297 ataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaat 396  Q
    |||| |||| |||||||  ||||||||||||||| ||||||||||||||||||| ||||||   || ||||||||||||||||||||||| ||||||| |    
26184203 ataatgcaactcaagagtctcaagactttgcaggcttcccaaaacagagatgtcgcccaaaatgacgttttcaactgatagagaacgaatattgatcatt 26184302  T
397 aactgaattgattttggtaatgat 420  Q
    |||| |||||| |||| |||||||    
26184303 aacttaattgaatttgctaatgat 26184326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 102 - 422
Target Start/End: Original strand, 18081556 - 18081876
Alignment:
102 atacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttca 201  Q
    |||||||||||||| ||||||||||||||||||||||||||  || ||||| |||||||||||||||||||| | ||||| |||||| ||||||||||||    
18081556 atacctttccaatgcaggtaaggttatttcctgacaaaaattgttaaaactatgacagaagtacaattcttcaagtgatgtgcatctttggataacttca 18081655  T
202 aatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataaa 301  Q
    |  ||||| || ||| ||||| |||| | |  ||||| ||||||||| ||||||||||   |   |||||||   | || ||||||||||| ||| | |     
18081656 ataggattgttacttctaatttcacatttttccaagttcaacagtctcagtttcttcagtttctgaatttcacatggaagttcatcaatttgacagtgat 18081755  T
302 gcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaat-aact 400  Q
     |||||||||||  || |||||||||||| ||||||||| |||||||| ||||||| | ||  |||||||| ||||||||||||| || |||||| ||||    
18081756 ccaattcaagagtctctagactttgcaggcttcccaaaatagagatgttacccaaatagactctttcaactaatagagaacgaatattcatcaatgaact 18081855  T
401 gaattgattttggtaatgatag 422  Q
     |||||||| ||||||||||||    
18081856 -aattgattgtggtaatgatag 18081876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 81; E-Value: 9e-38
Query Start/End: Original strand, 102 - 386
Target Start/End: Complemental strand, 27343744 - 27343460
Alignment:
102 atacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttca 201  Q
    |||||||| |||||| |||||||||||||||| ||||||| |||||||||| |   |||||||||||||||| | |||||||||||| ||||||||||||    
27343744 atacctttgcaatgttggtaaggttatttccttacaaaaaccattgaaactatccaagaagtacaattcttcaagtgatgggcatctttggataacttca 27343645  T
202 aatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataaa 301  Q
    ||||| |||||  || |||||  ||| | |  ||| | ||||| |||||  |||||||   || |||||||| | | || ||||||||||| ||||| |     
27343644 aatgggttattatttctaattttacacttttccaacttcaacaatctaaaattcttcagtttttcaatttcatgaggaagttcatcaatttcacaatgag 27343545  T
302 gcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaat 386  Q
     ||| |||||||  |||||||||||||||  ||| |||||||| ||||||| ||||  ||| ||| ||| |||||||||||||||    
27343544 tcaactcaagagtctcaagactttgcaggcctccaaaaacagaaatgtcactcaaaacaacttttgcaaatgatagagaacgaat 27343460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 76; E-Value: 9e-35
Query Start/End: Original strand, 95 - 386
Target Start/End: Complemental strand, 27370049 - 27369758
Alignment:
95 tgagaaaatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggat 194  Q
    ||||||||||||||| |||||| |||||||||||||||| |||| ||||||||||||| |    ||||||||||||||| | ||||| |||||| |||||    
27370049 tgagaaaatacctttgcaatgttggtaaggttatttccttacaagaatcattgaaactattcatgaagtacaattcttcaagtgatgtgcatctttggat 27369950  T
195 aacttcaaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaatttta 294  Q
     ||||||||||| | |||  || ||| |  ||||| | |||| ||||||| |||||  |||| ||   || |||||||| | | || |||||||||| ||    
27369949 tacttcaaatgggtcattatttctaactttacaatttttcaactccaacaatctaaaattctccagtttttcaatttcacgaggaagttcatcaattgta 27369850  T
295 caataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaat 386  Q
    || | |  ||| |||||||  |||||||||||||||  ||| ||| |||| ||||||||||||  |||| |||||| |||||||||||||||    
27369849 catttagtcaactcaagagtctcaagactttgcaggcctccaaaaccagaaatgtcacccaaatcaacactttcaaatgatagagaacgaat 27369758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 102 - 383
Target Start/End: Original strand, 18723685 - 18723966
Alignment:
102 atacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttca 201  Q
    |||||||| |||||| |||||||||||||||| |||| ||||||||||||| |   |||||||||||||||| | |||||||||||| ||||||||||||    
18723685 atacctttgcaatgttggtaaggttatttccttacaagaatcattgaaactattcaagaagtacaattcttcaagtgatgggcatctttggataacttca 18723784  T
202 aatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataaa 301  Q
    ||||| |||||  || |||||  ||| | | |||| ||||||| |||||  |||| ||   || |||||||| | | || ||||||||||  ||||| |     
18723785 aatgggttattatttctaattttacattttttcaactccaacaatctaaaattctccagtttttcaatttcacgaggaagttcatcaattgcacaatgag 18723884  T
302 gcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacg 383  Q
     ||||||||| |  ||||||| |||||||  ||| |   |||| ||||||||||||  ||  ||||||| ||||||||||||    
18723885 tcaattcaagtgtctcaagaccttgcaggcctccaattgcagaaatgtcacccaaatcaaatttttcaaatgatagagaacg 18723966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 28129539 - 28129462
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||||||||| |  ||| |||||||  ||||| ||||||||| ||||||||| ||||||||||||||||    
28129539 aattcatcaattttacaatcatccaaatcaagagtctcaaggctttgcaggtttcccaaaatagagatgtcacccaaa 28129462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 28143467 - 28143390
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||||||||| |  ||| |||||||  ||||| ||||||||| ||||||||| ||||||||||||||||    
28143467 aattcatcaattttacaatcatccaaatcaagagtctcaaggctttgcaggtttcccaaaatagagatgtcacccaaa 28143390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 283 - 357
Target Start/End: Original strand, 28513865 - 28513939
Alignment:
283 tcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||||||||  ||| |||||||  ||||| ||| ||||| ||||||||| ||||||||||||||||    
28513865 tcatcaattttacaataattcaaatcaagagtctcaaggcttcgcaggtttcccaaaatagagatgtcacccaaa 28513939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 27909387 - 27909310
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||| |||||||||  ||| ||||| |  ||||||||||||||| ||||||||| |||||| |||||||||    
27909387 aattcatcaatgttacaataatccaaatcaagtgtctcaagactttgcaggtttcccaaaatagagatttcacccaaa 27909310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 280 - 357
Target Start/End: Original strand, 28472843 - 28472920
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||||||||||||||||  ||| |||||||  ||||| ||| ||||| ||||||||| ||||||||| ||||||    
28472843 aattcatcaattttacaataactcaaatcaagagtctcaaggcttcgcaggtttcccaaaatagagatgtcgcccaaa 28472920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 283 - 357
Target Start/End: Original strand, 28492887 - 28492961
Alignment:
283 tcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||||||||  ||| |||||||  ||||| ||||| ||| |||| |||| ||||||||||||||||    
28492887 tcatcaattttacaataattcaaatcaagagtctcaaggctttgaaggtttccaaaaatagagatgtcacccaaa 28492961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 28078993 - 28078916
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||||||||||||| ||   || |||||||  ||||| ||| ||||| ||||||||| ||||||||||||||||    
28078993 aattcatcaattttacaaaaatataaatcaagagtctcaaggcttcgcaggtttcccaaaatagagatgtcacccaaa 28078916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 516 - 592
Target Start/End: Original strand, 18081991 - 18082067
Alignment:
516 aattagaatctcaagcttagagccatcaaacccagaggaatataaatccattagatttccttggaagaacaaatatt 592  Q
    ||||||||||||||| ||||| |||| |||| |||| ||| |||||||| ||||||| |||| | | ||||||||||    
18081991 aattagaatctcaagtttagacccataaaactcagatgaaaataaatcctttagattcccttcgcataacaaatatt 18082067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 307 - 357
Target Start/End: Original strand, 17749881 - 17749931
Alignment:
307 tcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||  ||||| ||||||||| ||||||||| ||||||||||||||||    
17749881 tcaagagtctcaaggctttgcaggtttcccaaaatagagatgtcacccaaa 17749931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 307 - 357
Target Start/End: Original strand, 19051201 - 19051251
Alignment:
307 tcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||  ||||| ||||||||| ||||||||| ||||||||||||||||    
19051201 tcaagagtctcaaggctttgcaggtttcccaaaatagagatgtcacccaaa 19051251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 26212965 - 26213015
Alignment:
440 tcaaaattcgaagccctaccatattttcaaagagtgaagtggggacatcct 490  Q
    |||||| |||||||||| |||||||||||| || ||||||| |||||||||    
26212965 tcaaaactcgaagccctgccatattttcaaggaatgaagtgtggacatcct 26213015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 11408383 - 11408306
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||| ||||  |  ||| |||||||  ||||| ||||||||| || |||||| ||||||||||||||||    
11408383 aattcatcaatttcacaaccatccaaatcaagagtctcaaggctttgcaggtttaccaaaatagagatgtcacccaaa 11408306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 514 - 543
Target Start/End: Original strand, 26213033 - 26213062
Alignment:
514 gcaattagaatctcaagcttagagccatca 543  Q
    ||||||||||||||||||||||||||||||    
26213033 gcaattagaatctcaagcttagagccatca 26213062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 28047020 - 28046943
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||||||   |||||||  ||| ||||| |  ||||||||||| ||| ||||||||| ||||||||||||||||    
28047020 aattcatcaatgcgacaataatccaaatcaagcgtctcaagactttgaaggtttcccaaaatagagatgtcacccaaa 28046943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 280 - 357
Target Start/End: Complemental strand, 28177622 - 28177545
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||||||||  |  ||| ||||| |  || |||||||| ||| ||||||||| ||||||||||||||||    
28177622 aattcatcaattttacaaccatccaaatcaagtgtctctagactttgaaggtttcccaaaatagagatgtcacccaaa 28177545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1344 (Bit Score: 101; Significance: 1e-49; HSPs: 1)
Name: scaffold1344
Description:

Target: scaffold1344; HSP #1
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 102 - 422
Target Start/End: Complemental strand, 431 - 111
Alignment:
102 atacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttca 201  Q
    |||||||| |||||| |||||||||||||||| |||||||||||||||||| |   |||||||||||||||| | |||||||||||| ||||||||||||    
431 atacctttgcaatgttggtaaggttatttccttacaaaaatcattgaaactattcaagaagtacaattcttcaagtgatgggcatctttggataacttca 332  T
202 aatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataaa 301  Q
    ||||| |||||  || ||||| |||||| | |||| ||||||| |||||  |||| ||   || ||||||| || | || ||| | ||||  ||||||      
331 aatgggttattatttctaatttcacaatttttcaactccaacaatctaaaattctccagtttttcaatttcgggaggaagttcgttaattgcacaatagt 232  T
302 gcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaataactg 401  Q
     ||| |||||||  ||||||||||||||| |||| |||||||| ||||||||||||  ||||||| ||| ||||||||||||||| || | ||||  ||     
231 tcaactcaagagtctcaagactttgcaggcttccaaaaacagaaatgtcacccaaatcaacatttccaaatgatagagaacgaatattcaacaatggctt 132  T
402 aattgattttggtaatgatag 422  Q
     ||||||| ||||||||||||    
131 cattgattgtggtaatgatag 111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0854 (Bit Score: 73; Significance: 5e-33; HSPs: 1)
Name: scaffold0854
Description:

Target: scaffold0854; HSP #1
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 102 - 422
Target Start/End: Original strand, 4740 - 5060
Alignment:
102 atacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggataacttca 201  Q
    |||||||| |||||| |||||||||||||||| |||| ||||| ||||||| |   ||| |||||||||||| | | || ||||||| ||||||||||||    
4740 atacctttgcaatgttggtaaggttatttccttacaagaatcaatgaaactattcaagatgtacaattcttcaagtaattggcatctttggataacttca 4839  T
202 aatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaattttacaataaa 301  Q
    ||||| |||||  || ||||| |||||| | |||| ||||||| |||||  ||||  |   || ||||||| || | || ||| | ||||  ||||||      
4840 aatgggttattatttctaatttcacaatttttcaactccaacaatctaaaattctctagtttttcaatttcgggaggaagttcgttaattgcacaatagt 4939  T
302 gcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatcaataactg 401  Q
     ||| |||||||  ||||||||||||||| |||| |||||||| ||||||||||||  ||| ||| ||| ||||||||||||||| || | ||||  ||     
4940 tcaactcaagagtctcaagactttgcaggcttccaaaaacagaaatgtcacccaaatcaacttttccaaatgatagagaacgaatattcaacaatggctt 5039  T
402 aattgattttggtaatgatag 422  Q
     ||||||| ||||||||||||    
5040 cattgattgtggtaatgatag 5060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0043 (Bit Score: 72; Significance: 2e-32; HSPs: 1)
Name: scaffold0043
Description:

Target: scaffold0043; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 95 - 422
Target Start/End: Original strand, 73502 - 73829
Alignment:
95 tgagaaaatacctttccaatgtaggtaaggttatttcctgacaaaaatcattgaaactgtgacagaagtacaattcttccaatgatgggcatctctggat 194  Q
    ||||| |||| |||| |||||| |||||||||||||||| |||| ||||||||||||| |   |||||||||||||||| | ||||| |||||| |||||    
73502 tgagacaatatctttgcaatgttggtaaggttatttccttacaagaatcattgaaactattcaagaagtacaattcttcaagtgatgtgcatctttggat 73601  T
195 aacttcaaatggattattgcttataattccacaatctgtcaagtccaacagtctaagtttcttcaacattgcaatttcaggggaaaattcatcaatttta 294  Q
    |||||||||||| |||||  || ||||   ||| | |  |||   ||||| |||||  ||||||||  || |||||||| | | || ||||||||||  |    
73602 aacttcaaatgggttattatttctaatataacacttttccaacgtcaacaatctaaaattcttcaatttttcaatttcatgaggaagttcatcaattgca 73701  T
295 caataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaacaaacattttcaactgatagagaacgaatgttgatca 394  Q
    |||| |  |||||||||||  |||||||||||||||  ||| |||||||| ||||||| ||||  ||| | | ||| ||||||||||||||| ||   ||    
73702 caatgagtcaattcaagagtctcaagactttgcaggcctccaaaaacagaaatgtcactcaaatcaacttgtgcaaatgatagagaacgaatattcgaca 73801  T
395 ataactgaattgattttggtaatgatag 422  Q
    ||| ||  ||||||| ||||||||||||    
73802 atagctccattgattgtggtaatgatag 73829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000004; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 280 - 357
Target Start/End: Original strand, 9330780 - 9330857
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||||||| |||||| |  ||| |||||||  |||||||||||||||||| |||||| |||||||||| |||||    
9330780 aattcatcaattgtacaatgattcaaatcaagagtctcaagactttgcagggtttccaaaatagagatgtcatccaaa 9330857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 280 - 357
Target Start/End: Original strand, 9384563 - 9384640
Alignment:
280 aattcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    |||||||||||| |||||| |  ||| |||||||  |||||||||||||||||| |||||| |||||||||| |||||    
9384563 aattcatcaattgtacaatgattcaaatcaagagtctcaagactttgcagggtttccaaaatagagatgtcatccaaa 9384640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 282 - 357
Target Start/End: Original strand, 8695210 - 8695285
Alignment:
282 ttcatcaattttacaataaagcaattcaagagattcaagactttgcagggttcccaaaacagagatgtcacccaaa 357  Q
    ||||||||||||||||| |  ||| ||||| |  ||||||||||| ||| ||||||||| ||||||||||||||||    
8695210 ttcatcaattttacaatgatccaaatcaagcgtctcaagactttgtaggtttcccaaaatagagatgtcacccaaa 8695285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204260 times since January 2019
Visitors: 1518