View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_94 (Length: 546)

Name: J5_8_94
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_94
J5_8_94
[»] chr3 (2 HSPs)
chr3 (60-546)||(43777229-43777715)
chr3 (1-63)||(43777711-43777774)


Alignment Details
Target: chr3 (Bit Score: 438; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 60 - 546
Target Start/End: Original strand, 43777229 - 43777715
Alignment:
60 aattcaatgcaatcacaaagtgaaacaatccatgaccgtctcgtcgagattgggctgtcctaaaaaacatatttagatattttttaaaactaaaattatt 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43777229 aattcaatgcaatcacaaagtgaaacaatccatgaccgtctcgtcgagattgggctgtcctaaaaaacatatttagatattttttaaaactaaaattatt 43777328  T
160 gactttgaactctagatcatctgacctcaatcgaacggtcacattgacagtgtgactggatgcagtctgtgattgcacagaatcctggtcccttccattg 259  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43777329 gactttgaactctagatcatctgacctcaatcgaacggtcacattgacagtgtgactggatgcagtctgtgattgcacagaatcctggtcccttccattg 43777428  T
260 acaccagttcaccttgaatccatatcaggcatcatatcaaccataaaaagcacgatttgaagttgcaaatatgtgtatgtaatgaaactcaatggagggt 359  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
43777429 acaccagttcaccttgaatccatatcaggcatcatatcaaccataaaaagcatgatttgaagttgcaaatatgtgtatgtaatgaaactcaatggagggt 43777528  T
360 gtgctaccaaaataggggcatcccttcttataattgtcacccaaaaagcaacattaatgtgtcagttacaacaattttcattagnnnnnnnnnnnnnnna 459  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||               |    
43777529 gtgctaccaaaataggggcatcccttcttataattgtcacccaaaaagcaacattaatgtgtcagttacaacaattttcattagtttttcatttttttta 43777628  T
460 gtgaggatgcatggatttggaagaaagttacaaatattctaatgtagcagtaattttgactttagaatgttcgtattttttccaaat 546  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43777629 gtgaggatgcatggatttggaagaaagttacaaatattctaatgtagcagtaattttgactttagaatgttcgtattttttccaaat 43777715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 43777711 - 43777774
Alignment:
1 caaatattcttt-gatatttgtaaagagtggtaacttcctagaaatttgttgcaacttgcaatt 63  Q
    |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||    
43777711 caaatattcttttgatatttgtaaagagttgtaacttcctagaaatttgttgcaacttgcaatt 43777774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110794 times since January 2019
Visitors: 1335