View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_8_95 (Length: 598)

Name: J5_8_95
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_8_95
J5_8_95
[»] chr5 (17 HSPs)
chr5 (212-598)||(8840349-8840735)
chr5 (35-136)||(8840765-8840866)
chr5 (277-464)||(27690401-27690588)
chr5 (310-495)||(22417278-22417463)
chr5 (40-117)||(36520430-36520507)
chr5 (312-505)||(36520560-36520754)
chr5 (277-464)||(28443086-28443273)
chr5 (409-487)||(22407455-22407533)
chr5 (303-455)||(16490110-16490263)
chr5 (372-460)||(32695106-32695195)
chr5 (341-464)||(32285542-32285666)
chr5 (50-133)||(25724168-25724251)
chr5 (50-133)||(27690138-27690221)
chr5 (59-119)||(10134596-10134656)
chr5 (59-119)||(28443464-28443524)
chr5 (407-463)||(13909917-13909973)
chr5 (413-449)||(16726758-16726794)
[»] chr3 (7 HSPs)
chr3 (212-598)||(20860195-20860585)
chr3 (310-464)||(29582249-29582404)
chr3 (43-126)||(20860073-20860156)
chr3 (50-123)||(36337847-36337920)
chr3 (413-464)||(25214522-25214573)
chr3 (413-455)||(36337629-36337671)
chr3 (412-446)||(40152950-40152984)
[»] chr1 (12 HSPs)
chr1 (303-570)||(28639812-28640080)
chr1 (392-515)||(35989946-35990069)
chr1 (383-570)||(41932412-41932600)
chr1 (308-458)||(48182347-48182497)
chr1 (43-120)||(35989752-35989829)
chr1 (383-570)||(41933334-41933522)
chr1 (50-132)||(28639662-28639744)
chr1 (43-126)||(41933190-41933273)
chr1 (294-493)||(7134538-7134736)
chr1 (341-464)||(34549900-34550024)
chr1 (212-267)||(7134459-7134511)
chr1 (226-258)||(28640126-28640158)
[»] chr6 (5 HSPs)
chr6 (131-215)||(4401370-4401454)
chr6 (402-461)||(17519961-17520020)
chr6 (410-495)||(33555082-33555167)
chr6 (59-117)||(33174452-33174510)
chr6 (308-388)||(33555190-33555270)
[»] chr2 (4 HSPs)
chr2 (311-571)||(815596-815857)
chr2 (43-82)||(815922-815961)
chr2 (411-464)||(21649647-21649701)
chr2 (412-470)||(25631319-25631377)
[»] chr4 (8 HSPs)
chr4 (310-571)||(52598248-52598508)
chr4 (308-386)||(19509167-19509245)
chr4 (279-429)||(42247161-42247312)
chr4 (411-464)||(20516778-20516831)
chr4 (401-463)||(34953533-34953595)
chr4 (411-464)||(40602858-40602911)
chr4 (308-389)||(50867416-50867497)
chr4 (50-123)||(52598565-52598638)
[»] chr8 (3 HSPs)
chr8 (396-597)||(32124283-32124484)
chr8 (309-464)||(17865037-17865192)
chr8 (59-133)||(32124157-32124231)
[»] chr7 (5 HSPs)
chr7 (372-464)||(42012320-42012413)
chr7 (410-500)||(18500446-18500536)
chr7 (308-391)||(48374322-48374406)
chr7 (405-450)||(3600952-3600997)
chr7 (420-464)||(19647067-19647111)
[»] scaffold0376 (1 HSPs)
scaffold0376 (311-387)||(7206-7282)


Alignment Details
Target: chr5 (Bit Score: 360; Significance: 0; HSPs: 17)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 212 - 598
Target Start/End: Original strand, 8840349 - 8840735
Alignment:
212 aattgcagggattctatgaatggtcagtgaccatgacatcataaacaatcataaaactnnnnnnngtttaagaaagactaagaaaatataggaagcgaag 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
8840349 aattgcagggattctatgaatggtcagtgaccatgacatcataaacaatcataaaactaaaaaaagtttaagaaagactaagaaaatataggaagcgaag 8840448  T
312 aatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttcatgatccaactgac 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8840449 aatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttcatgatccaactgac 8840548  T
412 caaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatccgaaagtctc 511  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8840549 caaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatccgaaagtctc 8840648  T
512 taaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttatttttgaagtgntttcntggcgaatgacatagg 598  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||    
8840649 taaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttatttttgaagtgttttcatggcgaatgacatagg 8840735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 35 - 136
Target Start/End: Original strand, 8840765 - 8840866
Alignment:
35 taatcaagcaacttcaaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagcttgccaat 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8840765 taatcaagcaacttcaaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagcttgccaat 8840864  T
135 tg 136  Q
    ||    
8840865 tg 8840866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 277 - 464
Target Start/End: Complemental strand, 27690588 - 27690401
Alignment:
277 gtttaagaaagactaagaaaatataggaagcgaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaact 376  Q
    ||||||||||   |||||||| || ||||| |||||||||||||||||||| ||| ||||| |  |||||||||| |  || | ||||||||   |||||    
27690588 gtttaagaaaatgtaagaaaagatgggaagtgaagaatgaatgaaattgttgaag-atgcaagcatatttatagccttaaatcagtcctagaccataact 27690490  T
377 acaatcaaaggaaactttttc-atgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    ||| ||||||||| | ||||| ||| |||||| |||||||||| ||||||||||  |||||||| |||||||||| | |||||||||||    
27690489 acagtcaaaggaagcgttttccatggtccaaccgaccaaaaatgcattaaacacttcacaaaccgtccaaacctttgatgaaacgccac 27690401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 310 - 495
Target Start/End: Complemental strand, 22417463 - 22417278
Alignment:
310 agaatgaatgaaattgttaaagcatgcaggactatttatag-cttataacctgtcctagattgtaactacaatcaaaggaaactttttcatgatccaact 408  Q
    ||||| |||||| ||||| ||||||||| |||||||||||  | || || || ||||||| |||||||||| ||||||||||| ||   |||    |||     
22417463 agaatcaatgaatttgttgaagcatgcaagactatttatattcgta-aatctatcctagactgtaactacagtcaaaggaaacattccaatgcataaacc 22417365  T
409 gaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattat 495  Q
    |||||||||||| |||||||||||||||||  | ||||||||||||||||||||||  |||||  || |||||||||||| ||||||    
22417364 gaccaaaaatactttaaacacaccacaaactgttcaaaccttgggtgaaacgccacaatccacacagtctgggaggtttcagattat 22417278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 36520507 - 36520430
Alignment:
40 aagcaacttcaaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgat 117  Q
    ||||| ||| |||||||||||||||| ||||||||||||||||| ||||||||||||  | ||| |||||||||||||    
36520507 aagcagcttaaaacaacacaataacataagtgatgaatcttctaggaaggtgttcaagcaggtgcttttgtacttgat 36520430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 312 - 505
Target Start/End: Complemental strand, 36520754 - 36520560
Alignment:
312 aatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttc-atgatccaactga 410  Q
    |||||||||||||||| || ||||||   ||||||||||| |  |||| ||| |||||| |||||||| | ||||||||  ||||| ||| ||  ||       
36520754 aatgaatgaaattgttgaaccatgcaattctatttatagccttaaaccagtcatagattataactacagtgaaaggaaatattttccatgctcggaccag 36520655  T
411 ccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatccgaa 505  Q
    |||||| ||||||||||||||||||||||  |||||||||| |||| || ||||  ||||| ||  ||||||||||||  ||| | |||||||||    
36520654 ccaaaattacattaaacacaccacaaaccgcccaaaccttgtgtgacacaccacactccacataatctgggaggtttcatattttacaatccgaa 36520560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 277 - 464
Target Start/End: Original strand, 28443086 - 28443273
Alignment:
277 gtttaagaaagactaagaaaatataggaagcgaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaact 376  Q
    |||||||||| | |||||||| || ||||| ||||||| |||||  ||||| ||  |||||   ||||||||||| |  ||||| ||||||||  |||||    
28443086 gtttaagaaaaagtaagaaaagatgggaagtgaagaattaatgactttgttgaat-atgcaaatctatttatagccttaaacctttcctagatcataact 28443184  T
377 acaatcaaaggaaac-tttttcatgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    ||| ||||| || || |||||||||  |||||   |||||||| |||||||||||||||||| | ||||||| || ||| |||||||||    
28443185 acagtcaaatgatacgtttttcatggcccaaccatccaaaaatgcattaaacacaccacaaatcgtccaaacatttggttaaacgccac 28443273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 409 - 487
Target Start/End: Complemental strand, 22407533 - 22407455
Alignment:
409 gaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggttt 487  Q
    ||||||||||||||||||||||||||||||  || ||| |||||||||||||| ||  |||||  || |||||||||||    
22407533 gaccaaaaatacattaaacacaccacaaactgtctaaatcttgggtgaaacgcgacagtccacacagtctgggaggttt 22407455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 303 - 455
Target Start/End: Complemental strand, 16490263 - 16490110
Alignment:
303 gaagcgaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttc-atga 401  Q
    |||| ||||||||||| ||  ||||| | |||||| |||||||||||||    ||  | ||||||| |||||||||| |||||||| || ||| | |||     
16490263 gaagtgaagaatgaattaatatgttataacatgcaagactatttatagccataaaattatcctagactgtaactacattcaaaggatacgtttacgatgc 16490164  T
402 tccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtg 455  Q
       ||| ||||||||||||||||||||||||||||||| || ||||||| ||||    
16490163 ctaaaccgaccaaaaatacattaaacacaccacaaaccgtcaaaacctttggtg 16490110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 372 - 460
Target Start/End: Original strand, 32695106 - 32695195
Alignment:
372 taactacaatcaaaggaaacttttt-catgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacg 460  Q
    |||||||||||||||||| | |||| ||||  ||||| | |||||||| ||||||| |||||||||||| ||||||| || |||||||||    
32695106 taactacaatcaaaggaagcgttttacatggcccaaccgtccaaaaatgcattaaatacaccacaaaccgtccaaacttttggtgaaacg 32695195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 464
Target Start/End: Original strand, 32285542 - 32285666
Alignment:
341 ctatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttc-atgatccaactgaccaaaaatacattaaacacaccacaaacc 439  Q
    ||||||||||| |  ||| | ||||||||  |||||||| ||||||||| | ||||| | |  ||||||  || ||||||||||||||||||||||||||    
32285542 ctatttatagccttaaacatatcctagatcataactacagtcaaaggaagcgttttccaaggcccaactatcccaaaatacattaaacacaccacaaacc 32285641  T
440 atccaaaccttgggtgaaacgccac 464  Q
     ||||||  || |||||||||||||    
32285642 gtccaaatttttggtgaaacgccac 32285666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 50 - 133
Target Start/End: Complemental strand, 25724251 - 25724168
Alignment:
50 aaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagcttgccaa 133  Q
    |||||||||||||||| |||||||||||||| |  |||||||||| |||| ||| ||||||| | |||||| || || ||||||    
25724251 aaacaacacaataacataagtgatgaatcttttgggaaggtgttcgaagaggtgcttttgtattagatccagctggcctgccaa 25724168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 50 - 133
Target Start/End: Complemental strand, 27690221 - 27690138
Alignment:
50 aaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagcttgccaa 133  Q
    |||||| | ||||||| ||||||||||| ||||  |||||||||| |||| ||||||||||||||| |||  ||||| ||||||    
27690221 aaacaagaaaataacataagtgatgaatattcttggaaggtgttcgaagaggtgattttgtacttgttcctgctagcctgccaa 27690138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 119
Target Start/End: Complemental strand, 10134656 - 10134596
Alignment:
59 aataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatcc 119  Q
    ||||| ||||||||||||||||||   ||||||||| |||| ||||||||| |||||||||    
10134656 aataatagaagtgatgaatcttcttgaaaggtgttcgaagaggtgattttgcacttgatcc 10134596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 119
Target Start/End: Original strand, 28443464 - 28443524
Alignment:
59 aataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatcc 119  Q
    ||||||| ||||||||||||||||  |||||||||| |||| ||| ||||| |||||||||    
28443464 aataacataagtgatgaatcttcttggaaggtgttcgaagaggtgcttttgaacttgatcc 28443524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 407 - 463
Target Start/End: Complemental strand, 13909973 - 13909917
Alignment:
407 ctgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgcca 463  Q
    ||||||||||| | |||||| ||||||||||||||| |||||||  ||| |||||||    
13909973 ctgaccaaaaaaatattaaaaacaccacaaaccatcaaaacctttagtgtaacgcca 13909917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 413 - 449
Target Start/End: Complemental strand, 16726794 - 16726758
Alignment:
413 aaaaatacattaaacacaccacaaaccatccaaacct 449  Q
    |||||||||||||||||||| ||||| ||||||||||    
16726794 aaaaatacattaaacacaccccaaactatccaaacct 16726758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 115; Significance: 4e-58; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 212 - 598
Target Start/End: Complemental strand, 20860585 - 20860195
Alignment:
212 aattgcagggattctatgaatggtcag---tgaccatgacatcataaacaatcataaaactnnnnnnn-gtttaagaaagactaagaaaatataggaagc 307  Q
    ||||||| |||||||||||||||||||   ||||||| ||||||||| || |  |||||||        ||||||||||   |||||||| ||  ||||     
20860585 aattgcaaggattctatgaatggtcagcaatgaccataacatcataagcacttctaaaacttaaaaaaagtttaagaaaacataagaaaagatgagaagt 20860486  T
308 gaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaac-tttttcatgatccaa 406  Q
    || ||||||||||||||||| ||||||| | | ||||||||||| |  ||||||||||||  | |||||||||| ||| ||||| ||||||||| |||||    
20860485 gatgaatgaatgaaattgttgaagcatgtaaggctatttatagccttaaacctgtcctaggctctaactacaatgaaatgaaacatttttcatgctccaa 20860386  T
407 ctgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatccgaaa 506  Q
    | || |||||||||||||||||| |||||||| || |||||||||||||||| |||||  ||||| ||| |||||||||||| |||||| ||||  ||||    
20860385 ccgatcaaaaatacattaaacac-ccacaaactattcaaaccttgggtgaaatgccacaatccacgtagtctgggaggtttcagattatacaatatgaaa 20860287  T
507 gtctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttatttttgaagtgntttcntggcgaatgacatagg 598  Q
     ||||||||| |||||||||||||||||  |||||| ||| || | ||||||||||| ||||||| ||   |||| |||||| |||||||||    
20860286 ctctctaaatattttcggattctacaatctgaacaacaccagaatgtgtttaagtttgatttttggaggattttcatggcgattgacatagg 20860195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 310 - 464
Target Start/End: Original strand, 29582249 - 29582404
Alignment:
310 agaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttca-tgatccaact 408  Q
    ||||| |||||| ||||| ||||||||| |  || |||||| |   ||||| |||||||||||||||||| | ||||||||| ||| || || ||||||     
29582249 agaattaatgaatttgttgaagcatgcaagggtacttataggtataaacctatcctagattgtaactacagtaaaaggaaacatttacaatgttccaacc 29582348  T
409 gaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||    
29582349 gaccgaaaatgcattaaacacaccacaaatcatccaaaccttgggtgaaacgccac 29582404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 20860156 - 20860073
Alignment:
43 caacttcaaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagc 126  Q
    |||||| |||||||||||||| ||||||||| ||||||||  |||| ||||| |||| ||| |||||| |||||||||||||||    
20860156 caacttaaaacaacacaataatagaagtgatcaatcttctgggaagatgttcgaagaggtgcttttgtgcttgatccaactagc 20860073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 50 - 123
Target Start/End: Original strand, 36337847 - 36337920
Alignment:
50 aaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaact 123  Q
    |||||||| ||||||||||||||||||   ||| |||| || ||| |||| ||| |||||||||||||||||||    
36337847 aaacaacataataacagaagtgatgaaatatctgagaatgttttcgaagaggtgcttttgtacttgatccaact 36337920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 464
Target Start/End: Complemental strand, 25214573 - 25214522
Alignment:
413 aaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |||||| ||||||||| |||||||||| |||||||||| | |||||||||||    
25214573 aaaaatgcattaaacataccacaaaccgtccaaacctttgctgaaacgccac 25214522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 36337629 - 36337671
Alignment:
413 aaaaatacattaaacacaccacaaaccatccaaaccttgggtg 455  Q
    |||||| |||||||||||||||||||| ||||||| |||||||    
36337629 aaaaatgcattaaacacaccacaaaccgtccaaactttgggtg 36337671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 412 - 446
Target Start/End: Complemental strand, 40152984 - 40152950
Alignment:
412 caaaaatacattaaacacaccacaaaccatccaaa 446  Q
    |||||||||||||||||||||||||||||| ||||    
40152984 caaaaatacattaaacacaccacaaaccattcaaa 40152950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 97; Significance: 2e-47; HSPs: 12)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 303 - 570
Target Start/End: Complemental strand, 28640080 - 28639812
Alignment:
303 gaagcgaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaacttttt-catga 401  Q
    |||| ||||||| |||||||||||| ||||||||| | ||||||||||| |  || |  ||||||| | |||||||| ||||||||||| |||| ||||     
28640080 gaagtgaagaataaatgaaattgttgaagcatgcaaggctatttatagccttaaatcattcctagactataactacagtcaaaggaaacattttacatgg 28639981  T
402 tccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatc 501  Q
    |||||| |||||||||| ||||||||||||||||||||||||||||||| | |||||||||||  | ||| |||  || |||||||| |||||| ||||     
28639980 tccaaccgaccaaaaatgcattaaacacaccacaaaccatccaaaccttagatgaaacgccacaattcacctagtatgtgaggtttcagattattcaatt 28639881  T
502 cgaaagtctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttattttt 570  Q
    ||||| ||||||||| ||||  |||| |||||| |||| || | | |||||||||||||||| ||||||    
28639880 cgaaactctctaaatattttaagattatacaatccgaataacatcagactatgtttaagtttgattttt 28639812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 392 - 515
Target Start/End: Complemental strand, 35990069 - 35989946
Alignment:
392 tttttcatgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcgga 491  Q
    |||| |||| |||||| |||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||  ||||| ||| |||||| ||||||||    
35990069 ttttccatggtccaaccgaccaaaaatgcattaaacacaccacaaaccgtccaaacattgggtgaaacgccacaatccacctagtctgggatgtttcgga 35989970  T
492 ttatgcaatccgaaagtctctaaa 515  Q
    || | |||||||||| ||| ||||    
35989969 ttttacaatccgaaactctataaa 35989946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 383 - 570
Target Start/End: Complemental strand, 41932600 - 41932412
Alignment:
383 aaaggaaacttttt-catgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctggg 481  Q
    ||||||||| |||| |||| | ||||||||||||||| |||||||||||||||||||| ||| |||||| |||||||||||||  ||||| |||  || |    
41932600 aaaggaaacattttacatggttcaactgaccaaaaatgcattaaacacaccacaaaccgtcccaacctttggtgaaacgccacaatccacctagtttgag 41932501  T
482 aggtttcggattatgcaatccgaaagtctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttattttt 570  Q
    || ||||||||||| |||||| ||  | ||| ||| |||||||||| || ||| |||| || ||  |||| ||||||||||| ||||||    
41932500 agttttcggattatacaatccaaacctttcttaatattttcggattgtataatccgaataacacgagactgtgtttaagtttcattttt 41932412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 308 - 458
Target Start/End: Complemental strand, 48182497 - 48182347
Alignment:
308 gaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttca-tgatccaa 406  Q
    |||||||||||||||||||| |||||||||  |||||||| | | |  ||||| ||||||| ||||| ||||||||||   ||| |||||| || |||||    
48182497 gaagaatgaatgaaattgttgaagcatgcaaaactatttaaaaccttaaacctatcctagactgtaaatacaatcaaacataacgttttcaatgctccaa 48182398  T
407 ctgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaa 458  Q
    | ||||||||||||||||||||||||||||| ||  ||||||||||||||||    
48182397 ccgaccaaaaatacattaaacacaccacaaa-cagtcaaaccttgggtgaaa 48182347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 43 - 120
Target Start/End: Complemental strand, 35989829 - 35989752
Alignment:
43 caacttcaaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatcca 120  Q
    |||||| |||||||| ||||||||||||||||||||||||  |||||||||| |||| || |||||||||||||||||    
35989829 caacttaaaacaacataataacagaagtgatgaatcttctgggaaggtgttcgaagatgtaattttgtacttgatcca 35989752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 383 - 570
Target Start/End: Complemental strand, 41933522 - 41933334
Alignment:
383 aaaggaaacttttt-catgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctggg 481  Q
    ||||||||| |||| |||| | |||| ||||||||||  ||||||||||||||||||| |||||||||| |||||||||||||  ||||| |||  || |    
41933522 aaaggaaacattttacatggttcaacggaccaaaaatggattaaacacaccacaaaccgtccaaacctttggtgaaacgccacaatccacctagtttgag 41933423  T
482 aggtttcggattatgcaatccgaaagtctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttattttt 570  Q
    || ||||| ||||| |||| | ||  | ||| ||| |||||||||| || ||| |||| || ||  |||| ||||||||||| ||||||    
41933422 agttttcgaattatacaattcaaacctttcttaatattttcggattgtataatccgaataacacgagactgtgtttaagtttcattttt 41933334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 50 - 132
Target Start/End: Complemental strand, 28639744 - 28639662
Alignment:
50 aaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagcttgcca 132  Q
    |||||||||||||| | |||||||||||||| || ||||||| ||||||| ||| |||||||||||||||| || ||||||||    
28639744 aaacaacacaataatataagtgatgaatcttttaggaaggtgctcaaagaggtgcttttgtacttgatccagctggcttgcca 28639662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 41933273 - 41933190
Alignment:
43 caacttcaaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagc 126  Q
    |||||| |||||||||||||||| |||||||| |||||||| |||||||||| ||||  || ||||||||||| |||| |||||    
41933273 caacttaaaacaacacaataacataagtgatggatcttctaggaaggtgttcgaagagatgcttttgtacttgctccagctagc 41933190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 294 - 493
Target Start/End: Original strand, 7134538 - 7134736
Alignment:
294 aaaatataggaagcgaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactt 393  Q
    ||||||| ||||| |||||||||||||||||||| |||||||||   ||||||||| |||  |  |  || |||||  |||||||| | ||| ||||| |    
7134538 aaaatatgggaagtgaagaatgaatgaaattgttgaagcatgcaatgctatttataactttaatacattcgtagatcataactacagttaaatgaaacgt 7134637  T
394 tttca-tgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggat 492  Q
    ||||| || |||||  || |||||| |||||||  ||||||||| || |  |||||||||||||||| |||| || ||| ||  |||||||||||| |||    
7134638 tttcattgctccaaacgatcaaaaacacattaa--acaccacaatccgtttaaaccttgggtgaaacaccacatttcacctaatctgggaggtttcagat 7134735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 464
Target Start/End: Original strand, 34549900 - 34550024
Alignment:
341 ctatttatagcttataacctgtcctagattgtaactacaatcaaaggaaactttttc-atgatccaactgaccaaaaatacattaaacacaccacaaacc 439  Q
    ||||||||||| || |||  |||||||||  |||||||||| |||  |||| ||||| |  ||||||| |  ||||||| ||||||||||||||| ||||    
34549900 ctatttatagcctaaaacaagtcctagatcataactacaattaaataaaacgttttccaccatccaaccgttcaaaaattcattaaacacaccactaacc 34549999  T
440 atccaaaccttgggtgaaacgccac 464  Q
     ||||||||||  ||||||||||||    
34550000 gtccaaacctttagtgaaacgccac 34550024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 267
Target Start/End: Original strand, 7134459 - 7134511
Alignment:
212 aattgcagggattctatgaatggtcagtgaccatgacatcataaacaatcataaaa 267  Q
    |||||||| |||||||||||||||   ||||||||||| |||||||| ||||||||    
7134459 aattgcagagattctatgaatggt---tgaccatgacaccataaacactcataaaa 7134511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 258
Target Start/End: Complemental strand, 28640158 - 28640126
Alignment:
226 tatgaatggtcagtgaccatgacatcataaaca 258  Q
    |||||| ||||||||||||||||||||||||||    
28640158 tatgaacggtcagtgaccatgacatcataaaca 28640126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 85; Significance: 3e-40; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 131 - 215
Target Start/End: Complemental strand, 4401454 - 4401370
Alignment:
131 caattgtgtctggttgggttggatcttcaatgtatagtggtttatatttggttttgatgcaatgacaggtttcacagcaagaatt 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4401454 caattgtgtctggttgggttggatcttcaatgtatagtggtttatatttggttttgatgcaatgacaggtttcacagcaagaatt 4401370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 402 - 461
Target Start/End: Original strand, 17519961 - 17520020
Alignment:
402 tccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgc 461  Q
    |||||| |||||||||| ||||||||||||||| ||||||||||||||| ||||||||||    
17519961 tccaaccgaccaaaaattcattaaacacaccactaaccatccaaacctttggtgaaacgc 17520020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 410 - 495
Target Start/End: Complemental strand, 33555167 - 33555082
Alignment:
410 accaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattat 495  Q
    ||||||||| ||||||| |||||||||||| | |||||||||||||  |||||||  |||||  || |||||||||||||||||||    
33555167 accaaaaatgcattaaatacaccacaaaccgttcaaaccttgggtgttacgccacaatccacacagtctgggaggtttcggattat 33555082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 59 - 117
Target Start/End: Complemental strand, 33174510 - 33174452
Alignment:
59 aataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgat 117  Q
    |||||||||||||| ||| |||||  |||||||||| |||| ||| |||||||||||||    
33174510 aataacagaagtgaagaaacttcttggaaggtgttcgaagatgtgcttttgtacttgat 33174452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 308 - 388
Target Start/End: Complemental strand, 33555270 - 33555190
Alignment:
308 gaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaagga 388  Q
    ||||||||||||||  |||| || |||||| | ||||||||||||   ||| | ||||||| |||||||||| ||||||||    
33555270 gaagaatgaatgaatatgttgaaccatgcaaggctatttatagctataaacatatcctagactgtaactacagtcaaagga 33555190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 3e-34; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 311 - 571
Target Start/End: Original strand, 815596 - 815857
Alignment:
311 gaatgaatgaaattgttaaagcatgcaggactatttatag-cttataacctgtcctagattgtaactacaatcaaaggaaac-tttttcatgatccaact 408  Q
    ||||||||||||||||| | ||||||| | |||||||||| |||| |||  ||||||||   |||||||| ||||||||||| ||||||||| ||||||     
815596 gaatgaatgaaattgttgatgcatgcaagcctatttatagtctta-aacaagtcctagaccataactacattcaaaggaaacgtttttcatggtccaacc 815694  T
409 gaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatccgaaagt 508  Q
    |||||||||| |||||||||||||||||||| || ||||||| ||||||||| ||  |||||| ||| | | | | ||| ||||||| |||||| ||  |    
815695 gaccaaaaatgcattaaacacaccacaaaccgtctaaacctttggtgaaacgtcatattccacctagtccgagggtttttggattatacaatccaaacct 815794  T
509 ctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttatttttg 571  Q
     ||||||| |||| ||||| || |||||||| |  ||| |||| ||||||||||| |||||||    
815795 gtctaaatatttttggattgtataattcgaatagcaccagactttgtttaagtttcatttttg 815857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 43 - 82
Target Start/End: Original strand, 815922 - 815961
Alignment:
43 caacttcaaacaacacaataacagaagtgatgaatcttct 82  Q
    |||||| |||||||||||||||| ||||||||||||||||    
815922 caacttaaaacaacacaataacataagtgatgaatcttct 815961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 411 - 464
Target Start/End: Complemental strand, 21649701 - 21649647
Alignment:
411 ccaaaaatacattaaacacaccacaaaccatccaaa-ccttgggtgaaacgccac 464  Q
    |||||||| |||||||||||||||||||| |||||| | |||| |||||||||||    
21649701 ccaaaaattcattaaacacaccacaaaccgtccaaatctttggatgaaacgccac 21649647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 412 - 470
Target Start/End: Complemental strand, 25631377 - 25631319
Alignment:
412 caaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttcca 470  Q
    ||||||| ||||||||||||||| |||  |||||||||| |||||||||| ||| ||||    
25631377 caaaaatgcattaaacacaccactaactgtccaaacctttggtgaaacgctacggtcca 25631319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 53; Significance: 4e-21; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 310 - 571
Target Start/End: Original strand, 52598248 - 52598508
Alignment:
310 agaatgaatgaaattgttaaagcatgcaggactatttatagcttataa-cctgtcctagattgtaactacaatcaaaggaaactttttcat-gatccaac 407  Q
    |||| ||||||| ||||| ||||||||| |||||| ||||| | |||| ||| |||||||||||||||||| ||||| ||||| ||| ||  | ||||||    
52598248 agaaagaatgaatttgttgaagcatgcaagactatgtatag-tcataaacctatcctagattgtaactacagtcaaaagaaacgtttacaaagctccaac 52598346  T
408 tgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaatccgaaag 507  Q
     ||||||||||| ||| |||||||||| |||  |||||||||  |||||||||||||  |||||  || |||| ||||||| ||| ||  |||| ||||     
52598347 cgaccaaaaatatattgaacacaccacgaactgtccaaacctctggtgaaacgccacaatccacacagtctggaaggtttccgatcatataatctgaaa- 52598445  T
508 tctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttatttttg 571  Q
     || ||||| |||| ||||| || ||| ||||||  ||| |||| | ||||||||| |||||||    
52598446 -ctataaatatttttggattgtataatccgaacaccaccagactctttttaagtttgatttttg 52598508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 308 - 386
Target Start/End: Original strand, 19509167 - 19509245
Alignment:
308 gaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaag 386  Q
    |||||||||||||||||||| ||| ||||| ||||||||||| ||   ||||| || ||||||||||||||||||||||    
19509167 gaagaatgaatgaaattgttgaagtatgcaagactatttataactataaacctatcttagattgtaactacaatcaaag 19509245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 279 - 429
Target Start/End: Original strand, 42247161 - 42247312
Alignment:
279 ttaagaaagactaagaaaatataggaagcgaagaatgaatgaaattgttaaagcatgcaggactatttatag-cttataacctgtcctagattgtaacta 377  Q
    |||||||| | |||||||  || ||| | |||||||||||||||||||| ||||||| | | |||||||||| | || ||||| ||||||||||||| ||    
42247161 ttaagaaaaagtaagaaatgatgggaggtgaagaatgaatgaaattgttgaagcatgaaag-ctatttatagtcata-aacctatcctagattgtaatta 42247258  T
378 caatcaaaggaaacttttt--catgatccaactgaccaaaaatacattaaacac 429  Q
     | ||||||||||||||||   ||| | |||||||||||||||  |||||||||    
42247259 tagtcaaaggaaacttttttcaatgcttcaactgaccaaaaatgtattaaacac 42247312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 411 - 464
Target Start/End: Original strand, 20516778 - 20516831
Alignment:
411 ccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |||||||| ||||||||||| ||| |||| |||||||||| |||||||||||||    
20516778 ccaaaaattcattaaacacatcactaaccgtccaaacctttggtgaaacgccac 20516831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 401 - 463
Target Start/End: Complemental strand, 34953595 - 34953533
Alignment:
401 atccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgcca 463  Q
    ||||||| | |||||||| |||||||||| |||| |||| |||||||| | ||||||||||||    
34953595 atccaaccgtccaaaaatgcattaaacactccactaaccgtccaaaccattggtgaaacgcca 34953533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 464
Target Start/End: Original strand, 40602858 - 40602911
Alignment:
411 ccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |||||||  |||||||||| |||| |||| |||||||||| |||||||||||||    
40602858 ccaaaaaatcattaaacaccccactaaccgtccaaacctttggtgaaacgccac 40602911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 308 - 389
Target Start/End: Original strand, 50867416 - 50867497
Alignment:
308 gaagaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaa 389  Q
    |||||||||||||||  ||| ||| ||||| | |||||||||||    || | ||||||||||||||||||| |||||||||    
50867416 gaagaatgaatgaaaacgttgaaggatgcaaggctatttatagccataaaacggtcctagattgtaactacagtcaaaggaa 50867497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 50 - 123
Target Start/End: Original strand, 52598565 - 52598638
Alignment:
50 aaacaacacaataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaact 123  Q
    |||||||| ||||||| |||||||||| ||| |  ||| |||||  |||| ||| |||||||||||||||||||    
52598565 aaacaacataataacataagtgatgaaacttttgggaatgtgtttgaagaggtgtttttgtacttgatccaact 52598638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 2e-20; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 396 - 597
Target Start/End: Complemental strand, 32124484 - 32124283
Alignment:
396 tcatgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattat 495  Q
    ||||| |||||| |||||||||| ||||||| |||| | ||||| |||||| ||||||||||||| ||   | ||| ||| |||||||||||| ||||||    
32124484 tcatggtccaaccgaccaaaaatgcattaaagacacaaaaaaccgtccaaatcttgggtgaaacgtcatagtgcacatagtctgggaggtttcagattat 32124385  T
496 gcaatccgaaagtctctaaatgttttcggattctacaattcgaacaatacctgactatgtttaagttttatttttgaagtgntttcntggcgaatgacat 595  Q
      ||||  ||   |||||||| |||||| ||| || |||  |||||| ||| |||| ||||||||||| ||||||| || | |||| |||| ||||||||    
32124384 ataatctcaactgctctaaatattttcgaattatataatctgaacaacaccagactgtgtttaagtttgatttttggagagctttcgtggcaaatgacat 32124285  T
596 ag 597  Q
    ||    
32124284 ag 32124283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 309 - 464
Target Start/End: Complemental strand, 17865192 - 17865037
Alignment:
309 aagaatgaatgaaattgttaaagcatgcaggactatttatag-cttataacctgtcctagattgtaactacaatcaaaggaaactttttc-atgatccaa 406  Q
    |||||||||| |||||||| ||  ||||| | |||||||||| |||| |||  ||| |||| | |||||||||||||||||||| ||||| ||  | |||    
17865192 aagaatgaataaaattgttgaacaatgcaaggctatttatagtctta-aactagtcatagactataactacaatcaaaggaaacgttttccatagttcaa 17865094  T
407 ctgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |  |||||||||  ||||||||| ||||||||| | |||||||||||||||| |||||    
17865093 ca-accaaaaatgaattaaacacgccacaaaccgttcaaaccttgggtgaaaagccac 17865037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 59 - 133
Target Start/End: Complemental strand, 32124231 - 32124157
Alignment:
59 aataacagaagtgatgaatcttctaagaaggtgttcaaagaagtgattttgtacttgatccaactagcttgccaa 133  Q
    ||||| |||| |||| ||||||| |  ||||||||||||||| || ||||||||||||||||||| || ||||||    
32124231 aataatagaaatgataaatcttcaagaaaggtgttcaaagaactgcttttgtacttgatccaactggcctgccaa 32124157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 6e-17; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 372 - 464
Target Start/End: Original strand, 42012320 - 42012413
Alignment:
372 taactacaatcaaaggaaactttttc-atgatccaactgaccaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |||||| | ||||||||||| ||||| ||| ||||||| |||||||||||||||||||| ||| |||| || ||||||||||||| ||||||||    
42012320 taactatagtcaaaggaaacattttctatggtccaactaaccaaaaatacattaaacacgccataaacaattcaaaccttgggtgcaacgccac 42012413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 410 - 500
Target Start/End: Original strand, 18500446 - 18500536
Alignment:
410 accaaaaatacattaaacacaccacaaaccatccaaaccttgggtgaaacgccacgttccacttagcctgggaggtttcggattatgcaat 500  Q
    ||||||||| |||||||||||||||||| | |||||||||| ||||||||  |||  ||||  ||| ||| |||||||| |||||| ||||    
18500446 accaaaaatgcattaaacacaccacaaatcgtccaaacctttggtgaaacatcaccgtccaactagtctgagaggtttcagattatacaat 18500536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 308 - 391
Target Start/End: Original strand, 48374322 - 48374406
Alignment:
308 gaagaatgaatgaaat-tgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaaggaaac 391  Q
    |||||||||||| | | |||| ||||||||| |||||||| || | |  ||||| || |||||||||||||||||||||||||||    
48374322 gaagaatgaatggagtatgttgaagcatgcaagactatttgtaaccttaaacctatcttagattgtaactacaatcaaaggaaac 48374406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 405 - 450
Target Start/End: Complemental strand, 3600997 - 3600952
Alignment:
405 aactgaccaaaaatacattaaacacaccacaaaccatccaaacctt 450  Q
    ||||| |||||||| ||||||||||||||| |||| ||||||||||    
3600997 aactgtccaaaaattcattaaacacaccactaaccgtccaaacctt 3600952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 420 - 464
Target Start/End: Original strand, 19647067 - 19647111
Alignment:
420 cattaaacacaccacaaaccatccaaaccttgggtgaaacgccac 464  Q
    |||||||||| |||| ||| ||||||||||| |||||||||||||    
19647067 cattaaacactccactaactatccaaacctttggtgaaacgccac 19647111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 311 - 387
Target Start/End: Original strand, 7206 - 7282
Alignment:
311 gaatgaatgaaattgttaaagcatgcaggactatttatagcttataacctgtcctagattgtaactacaatcaaagg 387  Q
    |||||||||||  |||| ||||||||| | |||||||||||    || || |||||||||||||||||| |||||||    
7206 gaatgaatgaatatgttgaagcatgcaaggctatttatagccataaaactatcctagattgtaactacagtcaaagg 7282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176027 times since January 2019
Visitors: 1577