View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-2 (Length: 604)

Name: NF0095-INSERTION-2
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095-INSERTION-2
NF0095-INSERTION-2
[»] chr7 (40 HSPs)
chr7 (91-544)||(509126-509579)
chr7 (275-528)||(583309-583560)
chr7 (1-125)||(583080-583205)
chr7 (1-87)||(510747-510833)
chr7 (541-604)||(509002-509065)
chr7 (544-604)||(5082680-5082740)
chr7 (541-604)||(31857037-31857100)
chr7 (540-604)||(26743189-26743253)
chr7 (541-604)||(26153988-26154051)
chr7 (544-602)||(41888735-41888793)
chr7 (546-596)||(42691885-42691935)
chr7 (198-234)||(583240-583276)
chr7 (541-597)||(22526259-22526314)
chr7 (544-596)||(25486792-25486844)
chr7 (541-597)||(28324731-28324787)
chr7 (544-604)||(36399899-36399959)
chr7 (541-596)||(2927198-2927253)
chr7 (541-604)||(5639630-5639693)
chr7 (541-596)||(10300833-10300888)
chr7 (541-604)||(11909268-11909331)
chr7 (541-604)||(13561133-13561196)
chr7 (541-604)||(16100236-16100299)
chr7 (541-604)||(20353061-20353124)
chr7 (541-596)||(24043152-24043207)
chr7 (541-596)||(43067036-43067091)
chr7 (546-596)||(24166194-24166244)
chr7 (541-595)||(48135539-48135593)
chr7 (543-596)||(27942400-27942453)
chr7 (543-596)||(32408167-32408220)
chr7 (544-596)||(2851052-2851104)
chr7 (541-597)||(12307890-12307946)
chr7 (541-597)||(24166274-24166330)
chr7 (544-604)||(26153919-26153979)
chr7 (544-596)||(34907741-34907793)
chr7 (541-597)||(35160760-35160816)
chr7 (544-596)||(40002761-40002813)
chr7 (541-593)||(41699071-41699123)
chr7 (544-604)||(41890081-41890141)
chr7 (544-604)||(43093493-43093553)
chr7 (544-596)||(46261666-46261718)
[»] chr5 (62 HSPs)
chr5 (526-604)||(36337788-36337870)
chr5 (543-604)||(5787483-5787544)
chr5 (541-597)||(7276196-7276252)
chr5 (541-604)||(13461554-13461617)
chr5 (541-604)||(21344522-21344585)
chr5 (541-604)||(37039765-37039828)
chr5 (541-604)||(37684974-37685037)
chr5 (543-602)||(38507931-38507990)
chr5 (541-604)||(43585568-43585631)
chr5 (546-604)||(3780984-3781042)
chr5 (543-604)||(9087581-9087642)
chr5 (544-596)||(566369-566421)
chr5 (544-596)||(4162879-4162931)
chr5 (544-604)||(5787555-5787615)
chr5 (541-597)||(16056818-16056874)
chr5 (544-604)||(23042038-23042098)
chr5 (544-604)||(32146831-32146891)
chr5 (544-604)||(33545887-33545947)
chr5 (544-604)||(34186431-34186491)
chr5 (544-604)||(34820629-34820689)
chr5 (541-604)||(4151155-4151218)
chr5 (541-596)||(6168752-6168807)
chr5 (544-599)||(8408867-8408922)
chr5 (541-596)||(8618470-8618525)
chr5 (541-596)||(12891300-12891355)
chr5 (541-604)||(13461623-13461686)
chr5 (541-596)||(18003869-18003924)
chr5 (541-604)||(31690977-31691040)
chr5 (544-599)||(35469472-35469527)
chr5 (541-604)||(37554351-37554414)
chr5 (544-599)||(40271286-40271341)
chr5 (541-596)||(40680313-40680368)
chr5 (544-599)||(40914189-40914244)
chr5 (541-599)||(11380259-11380317)
chr5 (541-595)||(18753684-18753738)
chr5 (547-597)||(38007770-38007820)
chr5 (546-596)||(39148536-39148586)
chr5 (544-597)||(3709460-3709513)
chr5 (543-596)||(15385830-15385883)
chr5 (543-596)||(15385885-15385938)
chr5 (547-604)||(34102079-34102136)
chr5 (544-597)||(34733377-34733430)
chr5 (543-604)||(38404152-38404213)
chr5 (541-597)||(2992654-2992710)
chr5 (544-596)||(6168691-6168743)
chr5 (544-596)||(7336867-7336919)
chr5 (544-596)||(8221955-8222007)
chr5 (541-597)||(8408802-8408858)
chr5 (544-596)||(8618409-8618461)
chr5 (541-597)||(8694556-8694612)
chr5 (541-597)||(9013025-9013081)
chr5 (541-597)||(9742747-9742803)
chr5 (541-597)||(11380189-11380245)
chr5 (544-604)||(13359165-13359225)
chr5 (544-596)||(14274146-14274198)
chr5 (543-599)||(15475915-15475971)
chr5 (544-604)||(18753615-18753675)
chr5 (544-596)||(21369349-21369401)
chr5 (550-602)||(25837600-25837652)
chr5 (541-597)||(31758879-31758935)
chr5 (544-596)||(37915762-37915814)
chr5 (544-596)||(38404224-38404276)
[»] chr2 (32 HSPs)
chr2 (544-604)||(44949418-44949478)
chr2 (541-604)||(33363632-33363695)
chr2 (541-604)||(26759089-26759152)
chr2 (541-604)||(28602220-28602283)
chr2 (541-604)||(32870295-32870358)
chr2 (543-604)||(42230526-42230587)
chr2 (541-596)||(3094933-3094988)
chr2 (541-596)||(3373038-3373093)
chr2 (541-596)||(7728506-7728561)
chr2 (541-604)||(10237605-10237668)
chr2 (541-596)||(15080911-15080966)
chr2 (541-596)||(18469014-18469069)
chr2 (541-596)||(19908517-19908572)
chr2 (541-604)||(29771791-29771854)
chr2 (541-604)||(33425370-33425433)
chr2 (541-596)||(42263027-42263082)
chr2 (541-604)||(42755086-42755149)
chr2 (541-596)||(43514768-43514823)
chr2 (541-596)||(44402157-44402212)
chr2 (543-597)||(44949353-44949407)
chr2 (544-596)||(5094916-5094968)
chr2 (543-599)||(7105189-7105245)
chr2 (544-596)||(17844027-17844079)
chr2 (544-596)||(20195365-20195417)
chr2 (544-596)||(21208968-21209020)
chr2 (544-596)||(27692614-27692666)
chr2 (544-596)||(32870361-32870413)
chr2 (544-604)||(33363563-33363623)
chr2 (541-597)||(37485983-37486039)
chr2 (541-597)||(37486072-37486128)
chr2 (544-604)||(42230598-42230658)
chr2 (544-596)||(44402096-44402148)
[»] chr4 (47 HSPs)
chr4 (541-604)||(48472834-48472897)
chr4 (541-599)||(34321391-34321449)
chr4 (541-599)||(38616372-38616430)
chr4 (541-596)||(7695202-7695257)
chr4 (541-604)||(8014187-8014250)
chr4 (541-604)||(24156143-24156206)
chr4 (541-596)||(35207451-35207506)
chr4 (541-604)||(48472758-48472821)
chr4 (541-604)||(49632321-49632384)
chr4 (543-596)||(23585886-23585939)
chr4 (541-598)||(33032896-33032953)
chr4 (544-604)||(11347123-11347183)
chr4 (544-604)||(34709579-34709639)
chr4 (544-596)||(36235754-36235806)
chr4 (544-596)||(48796251-48796303)
chr4 (541-596)||(171201-171256)
chr4 (541-596)||(9011757-9011812)
chr4 (541-596)||(31808334-31808389)
chr4 (541-604)||(34709648-34709711)
chr4 (541-596)||(36235690-36235745)
chr4 (541-596)||(39466716-39466771)
chr4 (541-604)||(40545300-40545363)
chr4 (541-596)||(47628293-47628348)
chr4 (541-596)||(48796188-48796243)
chr4 (546-604)||(18592349-18592407)
chr4 (542-596)||(54677362-54677416)
chr4 (541-602)||(23795584-23795645)
chr4 (544-597)||(35967457-35967510)
chr4 (544-597)||(36469947-36470000)
chr4 (552-597)||(38223948-38223993)
chr4 (543-604)||(53402995-53403056)
chr4 (544-596)||(171140-171192)
chr4 (544-596)||(2994797-2994849)
chr4 (544-596)||(7695141-7695193)
chr4 (544-596)||(15641235-15641287)
chr4 (541-597)||(18592418-18592474)
chr4 (544-596)||(30162623-30162675)
chr4 (544-596)||(31808398-31808450)
chr4 (547-599)||(34100178-34100230)
chr4 (541-601)||(39923893-39923953)
chr4 (544-596)||(45861017-45861069)
chr4 (544-604)||(48088014-48088074)
chr4 (544-596)||(51975200-51975252)
chr4 (544-604)||(52164539-52164599)
chr4 (544-604)||(52164635-52164695)
chr4 (541-597)||(54569429-54569485)
chr4 (544-596)||(54927117-54927169)
[»] chr3 (44 HSPs)
chr3 (541-604)||(38245655-38245718)
chr3 (541-604)||(54008511-54008574)
chr3 (544-604)||(17940192-17940252)
chr3 (541-597)||(26043323-26043379)
chr3 (542-601)||(7328717-7328776)
chr3 (541-604)||(14626701-14626764)
chr3 (543-602)||(37331674-37331733)
chr3 (541-596)||(39333363-39333418)
chr3 (541-604)||(46967530-46967593)
chr3 (541-596)||(47342655-47342710)
chr3 (544-597)||(1927512-1927565)
chr3 (543-596)||(11582761-11582814)
chr3 (544-597)||(17940255-17940308)
chr3 (543-604)||(29352803-29352864)
chr3 (547-604)||(29726353-29726410)
chr3 (547-604)||(29726445-29726502)
chr3 (547-604)||(29726537-29726594)
chr3 (544-604)||(32956422-32956482)
chr3 (544-604)||(33638990-33639050)
chr3 (544-604)||(38446743-38446803)
chr3 (546-602)||(47342588-47342644)
chr3 (541-596)||(16607427-16607482)
chr3 (541-604)||(22995769-22995832)
chr3 (541-604)||(25990722-25990785)
chr3 (541-604)||(25995615-25995678)
chr3 (541-604)||(33638918-33638981)
chr3 (541-596)||(35455575-35455630)
chr3 (541-596)||(38082526-38082581)
chr3 (541-596)||(39530407-39530462)
chr3 (546-604)||(28811592-28811650)
chr3 (547-604)||(25823679-25823736)
chr3 (546-599)||(29726299-29726352)
chr3 (544-596)||(4236592-4236644)
chr3 (548-604)||(7328647-7328703)
chr3 (544-604)||(17004962-17005022)
chr3 (547-595)||(29676285-29676333)
chr3 (469-509)||(30237063-30237103)
chr3 (544-596)||(34413197-34413249)
chr3 (544-604)||(34935542-34935602)
chr3 (544-596)||(35455639-35455691)
chr3 (541-577)||(36934527-36934563)
chr3 (544-596)||(39148765-39148817)
chr3 (543-599)||(48906136-48906192)
chr3 (544-604)||(54008283-54008343)
[»] chr8 (27 HSPs)
chr8 (546-604)||(41569579-41569637)
chr8 (541-604)||(2827360-2827423)
chr8 (541-596)||(45145675-45145730)
chr8 (541-599)||(26191842-26191900)
chr8 (544-596)||(42666193-42666245)
chr8 (541-596)||(8769653-8769708)
chr8 (541-596)||(11295931-11295986)
chr8 (541-596)||(27184287-27184342)
chr8 (541-596)||(33472997-33473052)
chr8 (541-596)||(42666129-42666184)
chr8 (546-604)||(1647044-1647102)
chr8 (543-599)||(2827431-2827485)
chr8 (543-604)||(17922155-17922215)
chr8 (543-604)||(24726039-24726100)
chr8 (543-596)||(32016849-32016902)
chr8 (544-597)||(35201887-35201940)
chr8 (544-597)||(40802214-40802267)
chr8 (544-597)||(44081964-44082017)
chr8 (544-596)||(1256166-1256218)
chr8 (544-596)||(5526573-5526625)
chr8 (544-596)||(7011868-7011920)
chr8 (544-596)||(12955833-12955885)
chr8 (544-596)||(18126067-18126119)
chr8 (544-604)||(26492385-26492445)
chr8 (544-596)||(40305024-40305076)
chr8 (544-596)||(40739567-40739619)
chr8 (544-604)||(43484008-43484068)
[»] chr1 (48 HSPs)
chr1 (543-596)||(22954784-22954837)
chr1 (541-596)||(45925317-45925372)
chr1 (543-604)||(24478740-24478801)
chr1 (543-604)||(38847377-38847438)
chr1 (544-596)||(15311484-15311536)
chr1 (544-604)||(27146100-27146160)
chr1 (544-596)||(31919916-31919968)
chr1 (544-596)||(35161296-35161348)
chr1 (541-601)||(37215179-37215239)
chr1 (544-596)||(38149440-38149492)
chr1 (544-604)||(38847306-38847366)
chr1 (544-596)||(42761309-42761361)
chr1 (544-596)||(47912648-47912700)
chr1 (541-604)||(6792423-6792486)
chr1 (541-596)||(11994872-11994927)
chr1 (541-596)||(18023686-18023741)
chr1 (541-596)||(24015081-24015136)
chr1 (541-596)||(31327579-31327634)
chr1 (541-596)||(31414829-31414884)
chr1 (541-596)||(34120926-34120981)
chr1 (541-596)||(35838791-35838846)
chr1 (541-604)||(38824295-38824358)
chr1 (541-596)||(39151736-39151791)
chr1 (541-596)||(42761245-42761300)
chr1 (541-604)||(45011492-45011555)
chr1 (545-603)||(33852909-33852967)
chr1 (545-603)||(33927951-33928009)
chr1 (541-599)||(42788401-42788459)
chr1 (543-597)||(47912583-47912637)
chr1 (541-602)||(9947827-9947888)
chr1 (541-594)||(30785574-30785627)
chr1 (544-593)||(39422078-39422127)
chr1 (543-596)||(45749071-45749124)
chr1 (543-596)||(49980669-49980722)
chr1 (544-596)||(435282-435334)
chr1 (544-604)||(1344372-1344432)
chr1 (544-604)||(7230135-7230195)
chr1 (544-596)||(12568513-12568565)
chr1 (544-596)||(13911354-13911406)
chr1 (544-604)||(15401874-15401934)
chr1 (544-596)||(15998223-15998275)
chr1 (544-596)||(22954848-22954900)
chr1 (544-604)||(26855977-26856037)
chr1 (546-602)||(27146030-27146086)
chr1 (541-597)||(34332959-34333015)
chr1 (544-596)||(42468919-42468971)
chr1 (544-596)||(43147511-43147563)
chr1 (544-596)||(44371258-44371310)
[»] chr6 (21 HSPs)
chr6 (544-604)||(13902027-13902087)
chr6 (541-604)||(2693666-2693729)
chr6 (541-596)||(12588778-12588833)
chr6 (544-597)||(7418951-7419004)
chr6 (544-604)||(2693738-2693798)
chr6 (541-597)||(13740209-13740265)
chr6 (541-597)||(13745709-13745765)
chr6 (541-596)||(14897059-14897114)
chr6 (541-596)||(25371016-25371071)
chr6 (541-596)||(28034027-28034082)
chr6 (541-604)||(32364020-32364083)
chr6 (543-596)||(383619-383672)
chr6 (543-596)||(24914352-24914405)
chr6 (541-594)||(30507072-30507125)
chr6 (544-597)||(31759400-31759453)
chr6 (544-596)||(2157633-2157685)
chr6 (541-597)||(7418886-7418942)
chr6 (544-596)||(10118630-10118682)
chr6 (544-596)||(25371080-25371132)
chr6 (544-596)||(26597241-26597293)
chr6 (548-604)||(32436270-32436326)
[»] scaffold0321 (2 HSPs)
scaffold0321 (541-596)||(1645-1700)
scaffold0321 (544-596)||(1709-1761)
[»] scaffold0110 (2 HSPs)
scaffold0110 (541-604)||(10160-10223)
scaffold0110 (541-604)||(17897-17960)
[»] scaffold0047 (1 HSPs)
scaffold0047 (541-604)||(65924-65987)
[»] scaffold0121 (2 HSPs)
scaffold0121 (543-604)||(17509-17570)
scaffold0121 (544-604)||(17438-17498)
[»] scaffold0200 (1 HSPs)
scaffold0200 (541-596)||(22375-22430)
[»] scaffold0067 (1 HSPs)
scaffold0067 (541-596)||(7041-7096)
[»] scaffold0036 (1 HSPs)
scaffold0036 (541-596)||(36483-36538)
[»] scaffold0002 (1 HSPs)
scaffold0002 (541-596)||(491862-491917)
[»] scaffold0136 (1 HSPs)
scaffold0136 (543-599)||(22519-22575)


Alignment Details
Target: chr7 (Bit Score: 422; Significance: 0; HSPs: 40)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 91 - 544
Target Start/End: Complemental strand, 509579 - 509126
Alignment:
91 taatattcccaactaattatggggtttcattgttccacatatacgagtttttgatttcgcatgcacgaagcaacttagcataagatttcaaaacatgcta 190  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||    
509579 taatattcccaactaattatggggtttcattgttccacatatatgagtttttgatttcgcatgcgcgaagcaacttagcataagatttcaaaacatgata 509480  T
191 actgtgccttcacaaaattcaaaacgtaaaacttgtgactacgcgaaaggagacataaagaatatgtgtatgtgaatgcacacaacataagcagaaaatg 290  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
509479 accgtgccttcacaaaattcaaaacgtaaaacttgtgactacgcgaaaggagacataaagaatatgtgtatgtgaatgcacacaacataagcagaaaatg 509380  T
291 agattttcttaagattaaggcccttaggactactcaaccttctaattactagttctaaaagaatcacaagggaatgtatatacacttggggtctacacaa 390  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
509379 agattttcttaagattaaggcccttaggactactcaaccttctaattactagttctaaaagaatcacaagggaatgtatatacacttggggtctacacaa 509280  T
391 cggaataactctaaaaactcttaggaaggatttcttatagagaaatgagagaggaaaaagagagtgttggaaacagtgaatactcctttggtcctaaatt 490  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||    
509279 cggaataactctaaaaactcttaggaaggatttcttatagagaaatgagagaggaaaaaaagagtgttggaaatattgaatactcctttggtcctaaatt 509180  T
491 ataagttattttggagaaattttttgttttaaactatactccttccgttttgaa 544  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
509179 ataagttattttggagaaattttttcttttaaactatactccttccgttttgaa 509126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 140; E-Value: 5e-73
Query Start/End: Original strand, 275 - 528
Target Start/End: Original strand, 583309 - 583560
Alignment:
275 acataagcagaaaatgagattttcttaagattaaggcccttagg-actactcaaccttctaattactagttctaaaagaatcacaagggaatgtatatac 373  Q
    ||||||||||||||||||||||||||||||||||||| |||||| |||| |||| ||||||||||||||||||||  |||||||||||||||||||||||    
583309 acataagcagaaaatgagattttcttaagattaaggcacttagggactaatcaatcttctaattactagttctaa--gaatcacaagggaatgtatatac 583406  T
374 acttggggtctacacaacggaataactctaaaaactcttaggaaggatttcttatagagaaatgagagaggaaaaagagagtgttggaaacagtgaatac 473  Q
    ||| |||||||||||| | |||| ||||||| ||||||||||||||||||| |||||||||||| |||||| |||| || |||||||||| |||||||||    
583407 actcggggtctacacagcagaatgactctaagaactcttaggaaggatttcctatagagaaatgggagagggaaaaaagtgtgttggaaatagtgaatac 583506  T
474 tcctttggtcctaaattataagttattttggagaaattttttgttttaaactata 528  Q
    ||| | | | |||||||| ||||  ||||||||||||||||||||| ||| ||||    
583507 tccctcgat-ctaaattacaagtcgttttggagaaattttttgtttcaaagtata 583560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 583080 - 583205
Alignment:
1 tgagtttcacaaacctcacatgggagagtaaagtgctaaggttttgaggagatatttcgtttaaaaaatgggaagaatgaagatataatataatat-tcc 99  Q
    |||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||  |||| |||||||||||||||||||||||| ||||||| |||    
583080 tgagtttcacaaacctcatatgggagagtaaaatgctaaggttttgaggagagattttatttagaaaatgggaagaatgaagatataaaataatatgtcc 583179  T
100 caactaattatggggtttcattgttc 125  Q
    | ||||||||||||||||||||||||    
583180 cgactaattatggggtttcattgttc 583205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 510833 - 510747
Alignment:
1 tgagtttcacaaacctcacatgggagagtaaagtgctaaggttttgaggagatatttcgtttaaaaaatgggaagaatgaagatata 87  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||| |||||||||||||||    
510833 tgagtttcacaaacctcacatgggagagtaaaatgctaaggttttgaggagatatttcatttagaaaatggaaagaatgaagatata 510747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 509065 - 509002
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
509065 tgaaccacatacatcattaaattaatgaacttaaaaacaaaattttgcttatatttaaagacgg 509002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 5082740 - 5082680
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||||||||||   ||||||||||||||||||||||||    
5082740 accacatacatcattaaatgaatgaacttaaaaagtcaattttgcttatatttaaagacgg 5082680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 31857100 - 31857037
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||||||||||   ||||||| ||||||||||||||||    
31857100 tgaaccacatacatcattaaataaatgaacttaaaaaatcaattttgattatatttaaagacgg 31857037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 540 - 604
Target Start/End: Original strand, 26743189 - 26743253
Alignment:
540 ttgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||||||| || |||||||||||   |||||| |||||||||||| ||||    
26743189 ttgaaccacatacatcattaaatgaatgaacttaaaaagtcaattttacttatatttaaaaacgg 26743253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 26153988 - 26154051
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| ||||||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
26153988 tgaatcacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 26154051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 544 - 602
Target Start/End: Complemental strand, 41888793 - 41888735
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    ||||||||||||||||||| ||||||| ||||||   ||||||||||| ||||||||||    
41888793 accacatacatcattaaatgaacgaacctaaaaagtcaattttgcttaaatttaaagac 41888735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 546 - 596
Target Start/End: Complemental strand, 42691935 - 42691885
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| |||||||||||   ||||||||||||||||    
42691935 cacatacatcattaaattaatgaacttaaaaagtgaattttgcttatattt 42691885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 198 - 234
Target Start/End: Original strand, 583240 - 583276
Alignment:
198 cttcacaaaattcaaaacgtaaaacttgtgactacgc 234  Q
    ||||||||||||||||| |||||||||||||||||||    
583240 cttcacaaaattcaaaatgtaaaacttgtgactacgc 583276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 22526314 - 22526259
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||||||||||  |||||||| |||||||||    
22526314 tgaaccacatacatcattaaatgaatgaacttaaaaa-taaattttgtttatattta 22526259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 25486792 - 25486844
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
25486792 accacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 25486844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 28324787 - 28324731
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   |||||||||||||||||    
28324787 tgaaccacatacatcattaaatgaatgaacataaaaattcaattttgcttatattta 28324731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 36399959 - 36399899
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||| ||| || |||| ||||||   ||||||||||||||||||||||||    
36399959 accacatacatcattgaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 36399899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 2927253 - 2927198
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
2927253 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 2927198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 5639630 - 5639693
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||| ||||||||| || |||  ||||||   ||||||||||||||||||||||||    
5639630 tgaaccacatacgtcattaaatgaatgaatctaaaaagtcaattttgcttatatttaaagacgg 5639693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 10300888 - 10300833
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
10300888 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 10300833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 11909331 - 11909268
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||| |||||| || |||||||||||   ||||||||||||||| ||| ||||    
11909331 tgaaccacatacatcgttaaatgaatgaacttaaaaagtcaattttgcttatattaaaaaacgg 11909268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 13561196 - 13561133
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||  ||  ||| ||||||  |||||||||||||||||||| ||||    
13561196 tgaaccacatacatcattaaaagaataaacctaaaaagtaaattttgcttatatttaaaaacgg 13561133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 16100236 - 16100299
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||| ||||| || ||| |||||||   ||||||||||||||||||| ||||    
16100236 tgaaccacatacatcaataaatgaatgaatttaaaaagtcaattttgcttatatttaaaaacgg 16100299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 20353124 - 20353061
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||| ||||||  ||| |||||||||||||||| ||||    
20353124 tgaaccacatacatcattaattgaatgaacctaaaaagtaaaatttgcttatatttaaaaacgg 20353061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 24043152 - 24043207
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||| |||||||||||| || |||| |||||| | ||||||||||||||||    
24043152 tgaaccacagacatcattaaatgaatgaacctaaaaagagaattttgcttatattt 24043207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 43067091 - 43067036
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| | || |||| ||||||  |||||||||||||||||    
43067091 tgaaccacatacatcattaattgaatgaacctaaaaagtaaattttgcttatattt 43067036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 546 - 596
Target Start/End: Original strand, 24166194 - 24166244
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| || |||| ||||||  |||||||||||||||||    
24166194 cacatacatcattaaatgaatgaacctaaaaattaaattttgcttatattt 24166244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 541 - 595
Target Start/End: Original strand, 48135539 - 48135593
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatt 595  Q
    |||||||||||||||||||||| || |||| ||||||   |||||||||||||||    
48135539 tgaaccacatacatcattaaataaatgaacataaaaaatcaattttgcttatatt 48135593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 27942400 - 27942453
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
27942400 aaccacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 27942453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 32408167 - 32408220
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
32408167 aaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 32408220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 2851052 - 2851104
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
2851052 accacatacatcattaaataaatgaacctaaaaagtgaattttgcttatattt 2851104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 12307890 - 12307946
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||| |||||||||    
12307890 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgattatattta 12307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 24166330 - 24166274
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||| |||||||| | || |||||||||||   |||||||||||||||||    
24166330 tgaaccacatatatcattaattgaatgaacttaaaaagtcaattttgcttatattta 24166274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 26153979 - 26153919
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| |||| ||||||   ||||||| ||||||| ||| ||||    
26153979 accacatacatcattaaattaatgaacctaaaaagtcaattttgtttatattaaaaaacgg 26153919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 34907741 - 34907793
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| || |||  |||||||||||||||||    
34907741 accacatacatcattaaatgaatgaacctataaagtaaattttgcttatattt 34907793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 35160816 - 35160760
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||| ||||||   |||||||||||||||||    
35160816 tgaaccacatacatcattaattgaatgaacctaaaaagtcaattttgcttatattta 35160760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 40002761 - 40002813
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  ||||||| |||||||||    
40002761 accacatacatcattaaatgaatgaacctaaaaagtaaattttacttatattt 40002813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 593
Target Start/End: Complemental strand, 41699123 - 41699071
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttata 593  Q
    |||||||||||||||||||||| || |||| ||||||   |||||||||||||    
41699123 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttata 41699071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 41890081 - 41890141
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||  || |||| ||||||   ||||||||||| ||||||||||||    
41890081 accacatacatcattaaacgaatgaacctaaaaaatcaattttgcttaaatttaaagacgg 41890141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 43093493 - 43093553
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||| ||||| | || |||| ||||||  |||||||||||||||||||| ||||    
43093493 accacatacataattaattcaatgaacctaaaaagtaaattttgcttatatttaaaaacgg 43093553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 46261718 - 46261666
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||| ||||||| ||||||| ||||||   ||||||||||||||||    
46261718 accacatacataattaaatgaacgaacctaaaaattgaattttgcttatattt 46261666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 62)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 526 - 604
Target Start/End: Original strand, 36337788 - 36337870
Alignment:
526 atactccttccgttt----tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||    |||||||||||||||||||||| || |||||||||||   ||||||||||||||||||| ||||    
36337788 atactccttccgtttcatatgaaccacatacatcattaaatgaatgaacttaaaaagtgaattttgcttatatttaaaaacgg 36337870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 543 - 604
Target Start/End: Complemental strand, 5787544 - 5787483
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||| |||||||| || |||||||||||   ||||||||||||||||||||||||    
5787544 aaccacatacaccattaaatgaatgaacttaaaaagtcaattttgcttatatttaaagacgg 5787483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 7276196 - 7276252
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||  ||||||||||||||||||    
7276196 tgaaccacatacatcattaaatgaaagaacctaaaaagtaaattttgcttatattta 7276252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 13461617 - 13461554
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
13461617 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaatacgg 13461554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 21344522 - 21344585
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||  ||||||   ||||||||||||||||||||||||    
21344522 tgaaccacatacatcattaaatgaatgaatctaaaaagtcaattttgcttatatttaaagacgg 21344585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 37039765 - 37039828
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
37039765 tgaaccacatacatcattaaatgaatgaacctaaaaatttaattttgcttatatttaaaaacgg 37039828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 37685037 - 37684974
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||||||||||  ||| |||||||||||||| ||||||    
37685037 tgaaccacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatatttagagacgg 37684974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 543 - 602
Target Start/End: Original strand, 38507931 - 38507990
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    ||||||||||||||||| || || |||||||||||   ||||||||||||||||||||||    
38507931 aaccacatacatcattagataaatgaacttaaaaagtcaattttgcttatatttaaagac 38507990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 43585568 - 43585631
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||| ||||||  |||||||||||||||||||| ||||    
43585568 tgaaccacatacatcattaattgaatgaacctaaaaagtaaattttgcttatatttaaaaacgg 43585631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 546 - 604
Target Start/End: Complemental strand, 3781042 - 3780984
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
3781042 cacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 3780984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 604
Target Start/End: Original strand, 9087581 - 9087642
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
9087581 aaccacatacatcattaaataaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 9087642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 566369 - 566421
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||| |||||||||| || |||| |||||| ||||||||||||||||||    
566369 accacatatatcattaaatgaatgaacctaaaaataaaattttgcttatattt 566421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 4162879 - 4162931
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
4162879 accacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattt 4162931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 5787555 - 5787615
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| |||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
5787555 accagatacatcattaaataaatgaacctaaaaattcaattttgcttatatttaaagacgg 5787615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 16056818 - 16056874
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   |||||||||||||||||    
16056818 tgaaccacatacatcattaaatgaatgaacctaaaaaattaattttgcttatattta 16056874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 23042038 - 23042098
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| ||||||  |||||||||||||||||||| ||||    
23042038 accacatacatcattaattcaatgaacctaaaaagtaaattttgcttatatttaaaaacgg 23042098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 32146891 - 32146831
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||| ||||||||||||| || |||| ||||||  |||||||||||||||||||| ||||    
32146891 accacgtacatcattaaataaatgaacctaaaaagtaaattttgcttatatttaaaaacgg 32146831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 33545887 - 33545947
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||  || ||||||| |||   ||||||||||||||||||||||||    
33545887 accacatacatcattaaacgaatgaacttataaaattaattttgcttatatttaaagacgg 33545947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 34186431 - 34186491
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| |||||||  ||||||||||||||||||| ||||    
34186431 accacatacatcattaattgaatgaacctaaaaactcaattttgcttatatttaaaaacgg 34186491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 34820689 - 34820629
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||||||||||   ||||||||||||||| ||| ||||    
34820689 accacatacatcattaaatgaatgaacttaaaaaattaattttgcttatattaaaatacgg 34820629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 4151218 - 4151155
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||| ||||| | || |||||||||||   ||||||||||||||||||| ||||    
4151218 tgaaccacatacattattaattgaatgaacttaaaaagtcaattttgcttatatttaaaaacgg 4151155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 6168752 - 6168807
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
6168752 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 6168807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 599
Target Start/End: Original strand, 8408867 - 8408922
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||||||||||||| || ||| |||||||   |||||||||||||||||||    
8408867 accacatacatcattaaatgaatgaatttaaaaagtcaattttgcttatatttaaa 8408922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 8618470 - 8618525
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
8618470 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 8618525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 12891355 - 12891300
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
12891355 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 12891300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 13461623 - 13461686
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||| ||| ||||    
13461623 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattaaaaaacgg 13461686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 18003924 - 18003869
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
18003924 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 18003869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 31691040 - 31690977
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||| |||||||||||||| || |||||||||||   ||||||||||||||| ||| ||||    
31691040 tgaaccatatacatcattaaatgaatgaacttaaaaagtcaattttgcttatattaaaatacgg 31690977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 599
Target Start/End: Original strand, 35469472 - 35469527
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||||||||||||| || |||| ||||||   |||||||||||||||||||    
35469472 accacatacatcattaaatgaatgaacgtaaaaagtcaattttgcttatatttaaa 35469527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 37554414 - 37554351
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||||||||||  ||| ||| |||||||||| ||||||    
37554414 tgaaccacatacatcattaattgaatgaacttaaaaagtaaaatttacttatatttagagacgg 37554351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 599
Target Start/End: Complemental strand, 40271341 - 40271286
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||||||||||||| || |||| ||| |||  |||||||||||||||||||    
40271341 accacatacatcattaaataaatgaacctaacaactcaattttgcttatatttaaa 40271286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 40680313 - 40680368
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
40680313 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 40680368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 599
Target Start/End: Original strand, 40914189 - 40914244
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||||||||||||| || |||| ||||||   |||||||||||||||||||    
40914189 accacatacatcattaaataaatgaacctaaaaagtcaattttgcttatatttaaa 40914244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 541 - 599
Target Start/End: Original strand, 11380259 - 11380317
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||||||||||||| || || |||| ||||||   |||||||||||||||||||    
11380259 tgaaccacatacatcattagatgaatgaacctaaaaagtcaattttgcttatatttaaa 11380317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 541 - 595
Target Start/End: Original strand, 18753684 - 18753738
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatt 595  Q
    |||||||||||||||||||||| || |||| ||||||   |||||||||||||||    
18753684 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatt 18753738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 547 - 597
Target Start/End: Original strand, 38007770 - 38007820
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||| || |||| ||||||  ||||||||||||||||||    
38007770 acatacatcattaaatgaatgaacctaaaaattaaattttgcttatattta 38007820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 546 - 596
Target Start/End: Original strand, 39148536 - 39148586
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| || |||| ||||||  |||||||||||||||||    
39148536 cacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattt 39148586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Original strand, 3709460 - 3709513
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||||| || |||| ||||||   |||||||||||||||||    
3709460 accacatacatcattaaatgaatgaacctaaaaaatcaattttgcttatattta 3709513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Complemental strand, 15385883 - 15385830
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
15385883 aaccacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 15385830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 15385885 - 15385938
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
15385885 aaccacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 15385938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 547 - 604
Target Start/End: Complemental strand, 34102136 - 34102079
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||| | || |||| ||||||  |||||||||||||||||||| ||||    
34102136 acatacatcattaattcaatgaacctaaaaaataaattttgcttatatttaaaaacgg 34102079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Complemental strand, 34733430 - 34733377
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||| |||||||||||||||  ||| ||||||  ||||||||||||||||||    
34733430 accacaaacatcattaaattaataaacctaaaaagtaaattttgcttatattta 34733377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 604
Target Start/End: Complemental strand, 38404213 - 38404152
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| ||||||||||||||| || |||| ||||||   |||||| |||||||||||||||||    
38404213 aaccgcatacatcattaaataaatgaacctaaaaaatcaattttacttatatttaaagacgg 38404152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 2992654 - 2992710
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||| ||||||||||||| ||  |||||||||| | |||||| ||||||||||    
2992654 tgaaccacgtacatcattaaatgaataaacttaaaaaaacaattttacttatattta 2992710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 6168743 - 6168691
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
6168743 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 6168691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 7336919 - 7336867
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| | || |||||| ||||  |||||||||||||||||    
7336919 accacatacatcattaattgaatgaacttcaaaagtaaattttgcttatattt 7336867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 8222007 - 8221955
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
8222007 accacatacatcattaaataaatgaacctaaaaaatgaattttgcttatattt 8221955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 8408858 - 8408802
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||| |||||||||| || |||| ||||||   |||||||||||||||||    
8408858 tgaaccacatatatcattaaatgaatgaacctaaaaaatcaattttgcttatattta 8408802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 8618461 - 8618409
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
8618461 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 8618409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 8694556 - 8694612
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||| |||||||||    
8694556 tgaaccacatacatcattaaataaatgaacctaaaaagtcaattttgtttatattta 8694612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 9013025 - 9013081
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   |||||| ||||||||||    
9013025 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaatttttcttatattta 9013081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 9742747 - 9742803
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   |||||| ||||||||||    
9742747 tgaaccacatacatcattaaatgaatgaacataaaaagtcaattttacttatattta 9742803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 11380245 - 11380189
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||||| || || |||| ||||||   |||||||||||||||||    
11380245 tgaaccacatacatcattagatgaatgaacctaaaaattgaattttgcttatattta 11380189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 13359225 - 13359165
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||| ||| ||||    
13359225 accacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattaaaaaacgg 13359165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 14274198 - 14274146
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || ||| ||||||   |||||||||||||||||    
14274198 accacatacatcattaaatgaatgaatttaaaatgtaaattttgcttatattt 14274146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 543 - 599
Target Start/End: Original strand, 15475915 - 15475971
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||| |||||||||| || |||||||||||   ||||||||||||| |||||    
15475915 aaccacatatatcattaaatgaatgaacttaaaaattcaattttgcttatagttaaa 15475971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 18753675 - 18753615
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||| ||| ||||    
18753675 accacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattaaaatacgg 18753615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 21369349 - 21369401
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||| ||| |||  ||||||  |||||||||||||||||    
21369349 accacatacatcattaaaataatgaatctaaaaagtaaattttgcttatattt 21369401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 550 - 602
Target Start/End: Original strand, 25837600 - 25837652
Alignment:
550 tacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    ||||||||||||| || |||| ||||||   ||||||||||||||||||||||    
25837600 tacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagac 25837652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 31758935 - 31758879
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||| |||||||||||||||| || |||| ||||||   |||||||||||||||||    
31758935 tgaacaacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattta 31758879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 37915814 - 37915762
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||||||||||   |||||| |||||||||    
37915814 accacatacatcattaaatgaatgaacttaaaaagtgaattttacttatattt 37915762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 38404224 - 38404276
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
38404224 accacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattt 38404276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 32)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 44949418 - 44949478
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||||||||||  |||||||||||||||||||| ||||    
44949418 accacatacatcattaaatgaatgaacttaaaaaataaattttgcttatatttaaaaacgg 44949478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 33363632 - 33363695
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
33363632 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 33363695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 26759089 - 26759152
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||| ||||||||||||    
26759089 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttaaatttaaagacgg 26759152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 28602220 - 28602283
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||| |||||||||| || |||||||||||  |||||||  ||||||||||||||||    
28602220 tgaaccacatatatcattaaatgaatgaacttaaaaagtaaattttatttatatttaaagacgg 28602283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 32870358 - 32870295
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   |||||||||||||||| |||||||    
32870358 tgaaccacatacatcattaaataaatgaacctaaaaagtgaattttgcttatattttaagacgg 32870295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 604
Target Start/End: Complemental strand, 42230587 - 42230526
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| || |||  ||||||   ||||||||||||||||||||||||    
42230587 aaccacatacatcattaaatgaatgaatctaaaaagtcaattttgcttatatttaaagacgg 42230526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 3094988 - 3094933
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
3094988 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 3094933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 3373038 - 3373093
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||||||||||   |||||| |||||||||    
3373038 tgaaccacatacatcattaaatgaatgaacttaaaaagtgaattttacttatattt 3373093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 7728506 - 7728561
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
7728506 tgaaccacatacatcattaaatgaatgaacctaaaaattgaattttgcttatattt 7728561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 10237668 - 10237605
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||| ||||||| || |||| ||||||   |||||| |||||||||||||||||    
10237668 tgaaccacatacattattaaatgaatgaacctaaaaagtcaattttacttatatttaaagacgg 10237605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 15080911 - 15080966
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
15080911 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 15080966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 18469014 - 18469069
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
18469014 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 18469069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 19908572 - 19908517
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
19908572 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 19908517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 29771791 - 29771854
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||| ||||||  ||| ||||||||||||| |||||||    
29771791 tgaaccacatacatcattaattgaatgaacataaaaagtaaaatttgcttatattttaagacgg 29771854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 33425370 - 33425433
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| ||||||||||||||||| || ||| |||||||   ||||||||||||||||||| ||||    
33425370 tgaatcacatacatcattaaatgaatgaatttaaaaagtcaattttgcttatatttaaaaacgg 33425433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 42263082 - 42263027
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || ||| |||||||   ||||||||||||||||    
42263082 tgaaccacatacatcattaaatgaatgaatttaaaaaatgaattttgcttatattt 42263027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 42755086 - 42755149
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||| |||||||||||||||| || ||| |||||||   ||||||| ||||||||||||||||    
42755086 tgaactacatacatcattaaatgaatgaaattaaaaagttaattttgtttatatttaaagacgg 42755149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 43514823 - 43514768
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
43514823 tgaaccacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 43514768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 44402157 - 44402212
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
44402157 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 44402212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 543 - 597
Target Start/End: Complemental strand, 44949407 - 44949353
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| || |||| ||||||   |||||||||||||||||    
44949407 aaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattta 44949353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 5094916 - 5094968
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||  ||||||  |||||||||||||||||    
5094916 accacatacatcattaaatgaatgaatctaaaaagtaaattttgcttatattt 5094968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 543 - 599
Target Start/End: Original strand, 7105189 - 7105245
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||| ||||| || |||| ||| |||  |||||||||||||||||||    
7105189 aaccacatacatcaataaataaatgaacctaacaactcaattttgcttatatttaaa 7105245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 17844027 - 17844079
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
17844027 accacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 17844079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 20195365 - 20195417
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| | || |||| ||||||| ||| |||||||||||||    
20195365 accacatacatcattaattgaatgaacctaaaaactaaaatttgcttatattt 20195417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 21208968 - 21209020
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
21208968 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 21209020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 27692666 - 27692614
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
27692666 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 27692614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 32870361 - 32870413
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
32870361 accacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattt 32870413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 33363623 - 33363563
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||| ||||||||||| || |||| ||||||  | |||||||||||||||||| ||||    
33363623 accacatgcatcattaaatgaatgaacctaaaaagtagattttgcttatatttaaaaacgg 33363563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 37486039 - 37485983
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||| ||||||  ||| ||||||||||||||    
37486039 tgaaccacatacatcattaattgaatgaacataaaaagtaaaatttgcttatattta 37485983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 37486072 - 37486128
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||| ||||||  ||| ||||||||||||||    
37486072 tgaaccacatacatcattaattgaatgaacctaaaaagtaaaatttgcttatattta 37486128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 42230598 - 42230658
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||| ||| ||||    
42230598 accacatacatcattaaatgaatgaacataaaaagtcaattttgcttatattaaaaaacgg 42230658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 44402148 - 44402096
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
44402148 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 44402096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 47)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 48472834 - 48472897
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||||||||| |||| ||||||   ||||||||||||||||||| ||||    
48472834 tgaaccacatacatcattaaattaatgaacctaaaaagttaattttgcttatatttaaatacgg 48472897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 541 - 599
Target Start/End: Complemental strand, 34321449 - 34321391
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||||||||| || |||| ||||||  ||||||||||||||||||||    
34321449 tgaaccacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatatttaaa 34321391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 541 - 599
Target Start/End: Complemental strand, 38616430 - 38616372
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||||||||| || ||||| |||||  ||||||||||||||||||||    
38616430 tgaaccacatacatcattaaatgaatgaactaaaaaagtaaattttgcttatatttaaa 38616372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 7695202 - 7695257
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
7695202 tgaaccacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 7695257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 8014250 - 8014187
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
8014250 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaatacgg 8014187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 24156206 - 24156143
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
24156206 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 24156143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 35207506 - 35207451
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
35207506 tgaaccacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 35207451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 48472821 - 48472758
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||||||||||   |||||| |||||||||||| ||||    
48472821 tgaaccacatacatcattaaatgaatgaacttaaaaagtcaattttacttatatttaaaaacgg 48472758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 49632384 - 49632321
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||| |||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
49632384 tgaaccatatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 49632321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 23585886 - 23585939
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
23585886 aaccacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattt 23585939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 541 - 598
Target Start/End: Complemental strand, 33032953 - 33032896
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaa 598  Q
    |||||||||||||||||||||| ||||||| ||||||   ||||||| ||||||||||    
33032953 tgaaccacatacatcattaaatgaacgaacctaaaaagtcaattttgtttatatttaa 33032896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 11347183 - 11347123
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||| |||||||||||| || |||| ||||||  |||||||||||||||||||| ||||    
11347183 accacaaacatcattaaatgaatgaacctaaaaaataaattttgcttatatttaaaaacgg 11347123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 34709639 - 34709579
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||  ||||||  |||||||||||||||||||| ||||    
34709639 accacatacatcattaaatgaatgaatctaaaaagtaaattttgcttatatttaaatacgg 34709579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 36235754 - 36235806
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
36235754 accacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 36235806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 48796251 - 48796303
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| |||| ||||||   ||||||||||||||||    
48796251 accacatacatcattaaattaatgaacctaaaaaatgaattttgcttatattt 48796303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 171201 - 171256
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
171201 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 171256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 9011812 - 9011757
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
9011812 tgaaccacatacatcattaaatgaatgaacataaaaagtgaattttgcttatattt 9011757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 31808389 - 31808334
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
31808389 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 31808334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 34709648 - 34709711
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||| ||| ||||    
34709648 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattaaaaaacgg 34709711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 36235745 - 36235690
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| |||| || |||||||||||   ||||||||||||||||    
36235745 tgaaccacatacatcataaaatgaatgaacttaaaaagtgaattttgcttatattt 36235690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 39466771 - 39466716
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
39466771 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 39466716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 40545363 - 40545300
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||| |||||||||||||| || ||| |||||||   |||||| |||||||||||||||||    
40545363 tgaaccaaatacatcattaaatgaatgaatttaaaaagtcaattttacttatatttaaagacgg 40545300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 47628348 - 47628293
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||| |||||||||||||| || |||| ||||||  |||||||||||||||||    
47628348 tgaaccagatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 47628293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 48796243 - 48796188
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
48796243 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 48796188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 546 - 604
Target Start/End: Complemental strand, 18592407 - 18592349
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
18592407 cacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 18592349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 542 - 596
Target Start/End: Complemental strand, 54677416 - 54677362
Alignment:
542 gaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
54677416 gaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 54677362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 541 - 602
Target Start/End: Complemental strand, 23795645 - 23795584
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    |||| |||||| |||||||||| || |||| ||||||   ||||||||||||||||||||||    
23795645 tgaatcacatatatcattaaatgaatgaacctaaaaaatcaattttgcttatatttaaagac 23795584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Original strand, 35967457 - 35967510
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||| ||| || |||||||||||   |||||||||||||||||    
35967457 accacatacatcatttaatgaatgaacttaaaaagtcaattttgcttatattta 35967510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Original strand, 36469947 - 36470000
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||||| || ||||| |||||   |||||||||||||||||    
36469947 accacatacatcattaaatgaatgaactcaaaaagtcaattttgcttatattta 36470000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 552 - 597
Target Start/End: Complemental strand, 38223993 - 38223948
Alignment:
552 catcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||| || ||||||||||| | |||||||||||||||||    
38223993 catcattaaatgaatgaacttaaaaaaacaattttgcttatattta 38223948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 604
Target Start/End: Complemental strand, 53403056 - 53402995
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||| | || |||| ||||||   ||||||||||||||||||| ||||    
53403056 aaccacatacatcattaattgaatgaacataaaaagtcaattttgcttatatttaaaaacgg 53402995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 171192 - 171140
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
171192 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 171140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 2994797 - 2994849
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
2994797 accacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 2994849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 7695193 - 7695141
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
7695193 accacatacatcattaaatgaatgaacataaaaagtgaattttgcttatattt 7695141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 15641287 - 15641235
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||| |||||||||||||| || |||||||||||   ||||||||||||||||    
15641287 accatatacatcattaaatgaatgaacttaaaaaatgaattttgcttatattt 15641235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 18592418 - 18592474
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||| |||||    
18592418 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttagattta 18592474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 30162675 - 30162623
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
30162675 accacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 30162623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 31808398 - 31808450
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||  ||||||  |||||||||||||||||    
31808398 accacatacatcattaaatgaatgaatctaaaaaataaattttgcttatattt 31808450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 547 - 599
Target Start/End: Original strand, 34100178 - 34100230
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||| || |||||||||||   ||||||| |||||||||||    
34100178 acatacatcattaaatgaatgaacttaaaaatttaattttgtttatatttaaa 34100230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 601
Target Start/End: Original strand, 39923893 - 39923953
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaaga 601  Q
    |||||||||||||||||||||| |  |||  ||||||   |||||||||||||||||||||    
39923893 tgaaccacatacatcattaaatgagtgaatctaaaaagtcaattttgcttatatttaaaga 39923953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 45861069 - 45861017
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
45861069 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 45861017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 48088074 - 48088014
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| ||||||   ||||||||||||||||||| ||||    
48088074 accacatacatcattaattgaatgaacataaaaagtcaattttgcttatatttaaaaacgg 48088014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 51975200 - 51975252
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||| | || |||||||||||  ||| |||||||||||||    
51975200 accacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattt 51975252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 52164599 - 52164539
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| |||||    ||||||||||||||||||| ||||    
52164599 accacatacatcattaaatgaatgaacctaaaaggtcaattttgcttatatttaaaaacgg 52164539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 52164635 - 52164695
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || ||| |||||||   |||||| |||||||||||| ||||    
52164635 accacatacatcattaaatgaatgaaattaaaaatttaattttccttatatttaaaaacgg 52164695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 54569429 - 54569485
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||| ||||||   |||||||||||||||||    
54569429 tgaaccacatacatcattaattgaatgaacctaaaaaattaattttgcttatattta 54569485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 54927169 - 54927117
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||  |||||||  ||||||||||||||||    
54927169 accacatacatcattaaatgaatgaatctaaaaactgaattttgcttatattt 54927117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 44)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 38245655 - 38245718
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||| |||||||||||||| || |||||||||||  ||||||| |||||||||||||||||    
38245655 tgaaccatatacatcattaaataaatgaacttaaaaagtaaattttacttatatttaaagacgg 38245718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 54008511 - 54008574
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||||||||||   || |||||||||||||||||||||    
54008511 tgaaccacatacatcattaaatgaatgaacttaaaaaatcaaatttgcttatatttaaagacgg 54008574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 17940252 - 17940192
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||||| ||||    
17940252 accacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatatttaaaaacgg 17940192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 26043323 - 26043379
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||||||||||  ||||||||||||||||||    
26043323 tgaaccacatacatcattaattgaatgaacttaaaaagtaaattttgcttatattta 26043379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 542 - 601
Target Start/End: Original strand, 7328717 - 7328776
Alignment:
542 gaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaaga 601  Q
    ||||||||||||||||||||| || |||| ||||||   |||||||||||||||||||||    
7328717 gaaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaga 7328776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 14626701 - 14626764
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || ||| |||||||   ||||||||||||||||||||||||    
14626701 tgaaccacatacatcattaattgaatgaatttaaaaagtcaattttgcttatatttaaagacgg 14626764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 543 - 602
Target Start/End: Original strand, 37331674 - 37331733
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||||||||    
37331674 aaccacatacatcattaaataaatgaacctaaaaagtcaattttgcttatatttaaagac 37331733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 39333363 - 39333418
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
39333363 tgaaccacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 39333418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 46967530 - 46967593
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||||||  | |||| ||||||   ||||||||||||||||||||||||    
46967530 tgaaccacatacatcattaaatggatgaacctaaaaagtcaattttgcttatatttaaagacgg 46967593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 47342655 - 47342710
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
47342655 tgaaccacatacatcattaaataaatgaacctaaaaagtaaattttgcttatattt 47342710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 544 - 597
Target Start/End: Complemental strand, 1927565 - 1927512
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||||| || |||||||||||  ||||||| ||||||||||    
1927565 accacatacatcattaaatgaatgaacttaaaaaataaattttacttatattta 1927512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 596
Target Start/End: Complemental strand, 11582814 - 11582761
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| |||||| | ||||||||||||||||    
11582814 aaccacatacatcattaaatgaatgaacctaaaaaaagaattttgcttatattt 11582761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 544 - 597
Target Start/End: Original strand, 17940255 - 17940308
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||||| || |||| ||||||  ||||||||||||||||||    
17940255 accacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattta 17940308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 604
Target Start/End: Original strand, 29352803 - 29352864
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| || |||| ||||||  ||||||| |||||||||||| ||||    
29352803 aaccacatacatcattaaatgaatgaacctaaaaaataaattttacttatatttaaaaacgg 29352864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 547 - 604
Target Start/End: Original strand, 29726353 - 29726410
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
29726353 acatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 29726410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 547 - 604
Target Start/End: Original strand, 29726445 - 29726502
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
29726445 acatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 29726502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 547 - 604
Target Start/End: Original strand, 29726537 - 29726594
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||| || |||| ||||||   ||||||||||||||||||||||||    
29726537 acatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaagacgg 29726594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 32956482 - 32956422
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
32956482 accacatacatcattaaataaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 32956422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 33638990 - 33639050
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
33638990 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatatttaaaaacgg 33639050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 38446803 - 38446743
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| |||||||||||||| || ||||||||||    ||||||||||||||||||||||||    
38446803 accatatacatcattaaatgaatgaacttaaaaggtcaattttgcttatatttaaagacgg 38446743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 546 - 602
Target Start/End: Complemental strand, 47342644 - 47342588
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    ||||||||||||||||| || |||| ||||||   ||||||||||||||||||||||    
47342644 cacatacatcattaaatgaatgaacctaaaaagttaattttgcttatatttaaagac 47342588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 16607427 - 16607482
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
16607427 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 16607482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 22995769 - 22995832
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||| ||||||  ||| |||||||||||||||| ||||    
22995769 tgaaccacatacatcattaattgaatgaacctaaaaagcaaaatttgcttatatttaaaaacgg 22995832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 25990722 - 25990785
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   | ||||||||||||||||| ||||    
25990722 tgaaccacatacatcattaaatgaatgaacctaaaaaattatttttgcttatatttaaaaacgg 25990785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 25995615 - 25995678
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   || |||||||||||||||| ||||    
25995615 tgaaccacatacatcattaaatgaatgaacctaaaaagtcaaatttgcttatatttaaaaacgg 25995678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 33638981 - 33638918
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||| |||||||||||||| ||  ||| ||||||  ||||||| |||||||||||||||||    
33638981 tgaaccatatacatcattaaatcaataaacctaaaaaataaattttacttatatttaaagacgg 33638918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 35455630 - 35455575
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
35455630 tgaaccacatacatcattaaatgaatgaacataaaaagtgaattttgcttatattt 35455575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 38082581 - 38082526
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
38082581 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 38082526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 39530462 - 39530407
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| | || |||||||||||   ||||||||||||||||    
39530462 tgaaccacatacatcattaattgaatgaacttaaaaagccaattttgcttatattt 39530407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 546 - 604
Target Start/End: Original strand, 28811592 - 28811650
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| || |||| ||||||   |||||| |||||||||||||||||    
28811592 cacatacatcattaaatgaatgaacctaaaaaatcaattttacttatatttaaagacgg 28811650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 547 - 604
Target Start/End: Original strand, 25823679 - 25823736
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||| ||||||| || |||||||||||   ||||||||||||||||||| ||||    
25823679 acatacattattaaatgaatgaacttaaaaagtcaattttgcttatatttaaaaacgg 25823736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 546 - 599
Target Start/End: Complemental strand, 29726352 - 29726299
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||||||||||||||| || |||| ||||||   |||||||||||||||||||    
29726352 cacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaa 29726299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 4236644 - 4236592
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  || ||||||||||||||    
4236644 accacatacatcattaaatgaatgaacctaaaaagtaatttttgcttatattt 4236592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 548 - 604
Target Start/End: Complemental strand, 7328703 - 7328647
Alignment:
548 catacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||| || |||| ||||||  || ||||||||||||||||| ||||    
7328703 catacatcattaaatgaatgaacctaaaaagtaatttttgcttatatttaaatacgg 7328647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 17005022 - 17004962
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| ||||||   ||||||||||||||||||| ||||    
17005022 accacatacatcattaattgaatgaacctaaaaaatcaattttgcttatatttaaaaacgg 17004962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 547 - 595
Target Start/End: Original strand, 29676285 - 29676333
Alignment:
547 acatacatcattaaattaacgaacttaaaaacaaaattttgcttatatt 595  Q
    |||||||||||||||| || |||||||||||   |||||||||||||||    
29676285 acatacatcattaaataaatgaacttaaaaaatcaattttgcttatatt 29676333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 469 - 509
Target Start/End: Complemental strand, 30237103 - 30237063
Alignment:
469 aatactcctttggtcctaaattataagttattttggagaaa 509  Q
    ||||||||||| |||||||||||||||| ||||| ||||||    
30237103 aatactcctttcgtcctaaattataagtcattttagagaaa 30237063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 34413197 - 34413249
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||  ||||||  |||||||||||||||||    
34413197 accacatacatcattaaatgaatgaatctaaaaaataaattttgcttatattt 34413249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 34935602 - 34935542
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| ||||||  ||| |||||||||||||||| ||||    
34935602 accacatacatcattaattgaatgaacctaaaaagtaaaatttgcttatatttaaaaacgg 34935542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 35455639 - 35455691
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
35455639 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 35455691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 577
Target Start/End: Original strand, 36934527 - 36934563
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaa 577  Q
    |||||||||||||||||||||| || |||||||||||    
36934527 tgaaccacatacatcattaaataaatgaacttaaaaa 36934563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 39148765 - 39148817
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| ||  ||| ||||||  |||||||||||||||||    
39148765 accacatacatcattaaatgaataaacctaaaaagtaaattttgcttatattt 39148817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 543 - 599
Target Start/End: Complemental strand, 48906192 - 48906136
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||||||| || |||| ||| |||  |||||| ||||||||||||    
48906192 aaccacatacatcattaaatgaatgaacctaacaacttaattttacttatatttaaa 48906136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 54008283 - 54008343
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| |||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
54008283 accatatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 54008343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 546 - 604
Target Start/End: Original strand, 41569579 - 41569637
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| || |||||||||||   ||||||||||||||||||||||||    
41569579 cacatacatcattaaatgaatgaacttaaaaagtcaattttgcttatatttaaagacgg 41569637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 2827423 - 2827360
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||||||||||   |||||| |||||||||||| ||||    
2827423 tgaaccacatacatcattaaatgaatgaacttaaaaagtcaattttacttatatttaaaaacgg 2827360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 45145675 - 45145730
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||||||||| |||| ||||||   ||||||||||||||||    
45145675 tgaaccacatacatcattaaattaatgaacctaaaaaatgaattttgcttatattt 45145730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 541 - 599
Target Start/End: Original strand, 26191842 - 26191900
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||||||||| ||||||| ||||||   ||||||| |||||||||||    
26191842 tgaaccacatacatcattaaataaacgaacctaaaaaattaattttgtttatatttaaa 26191900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 42666193 - 42666245
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| |||||| | ||||||||||||||||    
42666193 accacatacatcattaaatgaatgaacctaaaaaaagaattttgcttatattt 42666245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 8769708 - 8769653
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
8769708 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 8769653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 11295986 - 11295931
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
11295986 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 11295931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 27184287 - 27184342
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||| ||||||| || |||| ||||||  |||||||||||||||||    
27184287 tgaaccacatacataattaaatgaatgaacctaaaaagtaaattttgcttatattt 27184342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 33473052 - 33472997
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
33473052 tgaaccacatacatcattaaatgaatgaacataaaaattgaattttgcttatattt 33472997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 42666184 - 42666129
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
42666184 tgaaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 42666129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 546 - 604
Target Start/End: Complemental strand, 1647102 - 1647044
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| || |||| ||||||  |||||||||||||||| ||| ||||    
1647102 cacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattaaaatacgg 1647044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 599
Target Start/End: Original strand, 2827431 - 2827485
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||||||| || |||| |||||| ||||  |||||||||||||||    
2827431 aaccacatacatcattaaatgaatgaacctaaaaaaaaaa--ttgcttatatttaaa 2827485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 604
Target Start/End: Complemental strand, 17922215 - 17922155
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| || |||  ||||||  || ||||||||||||||||||||||    
17922215 aaccacatacatcattaaatgaatgaaactaaaaatcaa-ttttgcttatatttaaagacgg 17922155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 604
Target Start/End: Complemental strand, 24726100 - 24726039
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||| |||||||| | ||||||| ||||||  ||| |||||||||||||||| ||||    
24726100 aaccacatatatcattaattgaacgaacctaaaaagtaaaatttgcttatatttaaaaacgg 24726039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 32016849 - 32016902
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
32016849 aaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 32016902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Complemental strand, 35201940 - 35201887
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||| ||||| || |||| ||||||  ||||||||||||||||||    
35201940 accacatacatcaataaatgaatgaacctaaaaagtaaattttgcttatattta 35201887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Complemental strand, 40802267 - 40802214
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||| | || |||||||||||  ||| ||||||||||||||    
40802267 accacatacatcattaattgaatgaacttaaaaagtaaaatttgcttatattta 40802214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Complemental strand, 44082017 - 44081964
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||| |||||||||||||| |||| ||||||   |||||||||||||||||    
44082017 accacatgcatcattaaattaatgaacctaaaaaatcaattttgcttatattta 44081964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 1256166 - 1256218
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
1256166 accacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 1256218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 5526573 - 5526625
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
5526573 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 5526625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 7011868 - 7011920
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
7011868 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 7011920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 12955885 - 12955833
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
12955885 accacatacatcattaaataaatgaacctaaaaaatgaattttgcttatattt 12955833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 18126119 - 18126067
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
18126119 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 18126067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 26492385 - 26492445
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| ||||||  |||||||| ||||||||||| ||||    
26492385 accacatacatcattaattcaatgaacctaaaaagtaaattttgtttatatttaaaaacgg 26492445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 40305076 - 40305024
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
40305076 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 40305024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 40739567 - 40739619
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| ||  ||| ||||||  |||||||||||||||||    
40739567 accacatacatcattaaatgaataaacctaaaaagtaaattttgcttatattt 40739619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 43484008 - 43484068
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||| ||||||  ||| |||||||||||||||| ||||    
43484008 accacatacatcattaattgaatgaacctaaaaagtaaaatttgcttatatttaaaaacgg 43484068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000004; HSPs: 48)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 543 - 596
Target Start/End: Complemental strand, 22954837 - 22954784
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||||||||||  |||||||||||||||||    
22954837 aaccacatacatcattaaatgaatgaacttaaaaagtaaattttgcttatattt 22954784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 45925317 - 45925372
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
45925317 tgaaccacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 45925372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 604
Target Start/End: Original strand, 24478740 - 24478801
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||| | || |||||||||||  ||| |||||||||||||||| ||||    
24478740 aaccacatacatcattaattaaatgaacttaaaaagtaaaatttgcttatatttaaaaacgg 24478801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 604
Target Start/End: Original strand, 38847377 - 38847438
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
38847377 aaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 38847438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 15311536 - 15311484
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||||||||||   ||||||||||||||||    
15311536 accacatacatcattaaatgaatgaacttaaaaagtgaattttgcttatattt 15311484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 27146100 - 27146160
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
27146100 accacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 27146160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 31919916 - 31919968
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
31919916 accacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattt 31919968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 35161296 - 35161348
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||||||||||   ||||||||||||||||    
35161296 accacatacatcattaaatcaatgaacttaaaaagtgaattttgcttatattt 35161348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 541 - 601
Target Start/End: Complemental strand, 37215239 - 37215179
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaaga 601  Q
    |||||||||||||||||||||| || |||  ||||||   |||||||||||||||||||||    
37215239 tgaaccacatacatcattaaatgaatgaatctaaaaagtcaattttgcttatatttaaaga 37215179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 38149440 - 38149492
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||||||||||   ||||||||||||||||    
38149440 accacatacatcattaaatgaatgaacttaaaaaatgaattttgcttatattt 38149492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 38847366 - 38847306
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||||||||||   | ||||||||||||||||| ||||    
38847366 accacatacatcattaaatgaatgaacttaaaaaattatttttgcttatatttaaaaacgg 38847306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 42761309 - 42761361
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||||||||||  ||||||| |||||||||    
42761309 accacatacatcattaaatgaatgaacttaaaaagtaaattttacttatattt 42761361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 47912648 - 47912700
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
47912648 accacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 47912700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 6792423 - 6792486
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| |||||| |||||||||| || |||| ||||||  ||||||| |||||||||||||||||    
6792423 tgaatcacatatatcattaaatgaatgaacctaaaaagtaaattttacttatatttaaagacgg 6792486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 11994927 - 11994872
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| ||  ||||||||||   ||||||||||||||||    
11994927 tgaaccacatacatcattaaataaataaacttaaaaagtgaattttgcttatattt 11994872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 18023686 - 18023741
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
18023686 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 18023741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 24015081 - 24015136
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| ||  ||| ||||||  |||||||||||||||||    
24015081 tgaaccacatacatcattaaatgaataaacctaaaaagtaaattttgcttatattt 24015136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 31327634 - 31327579
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||| |||||||||||||| || |||| |||||||  ||||||||||||||||    
31327634 tgaaccatatacatcattaaatgaatgaacctaaaaactgaattttgcttatattt 31327579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 31414829 - 31414884
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
31414829 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 31414884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 34120981 - 34120926
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
34120981 tgaaccacatacatcattaaataaatgaacctaaaaagtgaattttgcttatattt 34120926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 35838791 - 35838846
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
35838791 tgaaccacatacatcattaaataaatgaacctaaaaagtgaattttgcttatattt 35838846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 38824358 - 38824295
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| | || |||| ||||||  ||| |||||||||||||||| ||||    
38824358 tgaaccacatacatcattaattgaatgaacataaaaaataaaatttgcttatatttaaaaacgg 38824295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 39151791 - 39151736
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
39151791 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 39151736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 42761300 - 42761245
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
42761300 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 42761245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 45011555 - 45011492
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||| ||||||| || ||| |||||||   |||||| |||||||||||||||||    
45011555 tgaaccacatacattattaaatgaatgaaattaaaaaatcaattttacttatatttaaagacgg 45011492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 545 - 603
Target Start/End: Complemental strand, 33852967 - 33852909
Alignment:
545 ccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacg 603  Q
    |||||||||||||||||| || |||| || |||   |||||||||||||||||||||||    
33852967 ccacatacatcattaaatgaatgaacctataaagtcaattttgcttatatttaaagacg 33852909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 545 - 603
Target Start/End: Original strand, 33927951 - 33928009
Alignment:
545 ccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacg 603  Q
    |||||||||||||||||| || |||| || |||   |||||||||||||||||||||||    
33927951 ccacatacatcattaaatgaatgaacctataaagtcaattttgcttatatttaaagacg 33928009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 541 - 599
Target Start/End: Original strand, 42788401 - 42788459
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    |||||||||||||||||||||| || |||  ||||||   |||||||||||||||||||    
42788401 tgaaccacatacatcattaaatgaatgaatctaaaaaatcaattttgcttatatttaaa 42788459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 543 - 597
Target Start/End: Complemental strand, 47912637 - 47912583
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| || |||| ||||||   |||||||||||||||||    
47912637 aaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatattta 47912583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 541 - 602
Target Start/End: Original strand, 9947827 - 9947888
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    |||||||||||||||||||||| || |||  ||||||   |||||| |||||||||||||||    
9947827 tgaaccacatacatcattaaatgaatgaatctaaaaagtcaattttacttatatttaaagac 9947888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 541 - 594
Target Start/End: Complemental strand, 30785627 - 30785574
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatat 594  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||    
30785627 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatat 30785574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 593
Target Start/End: Complemental strand, 39422127 - 39422078
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttata 593  Q
    ||||||||||||||||| | ||||||| ||||||  ||||||||||||||    
39422127 accacatacatcattaattgaacgaacctaaaaagtaaattttgcttata 39422078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 45749071 - 45749124
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||| |||||| || |||||||||||   ||||||||||||||||    
45749071 aaccacatacatcgttaaatgaatgaacttaaaaagtcaattttgcttatattt 45749124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Original strand, 49980669 - 49980722
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
49980669 aaccacatacatcattaaatgaatgaacctaaaaaatgaattttgcttatattt 49980722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 435282 - 435334
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
435282 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 435334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 1344432 - 1344372
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||| |||||||||||||| || |||| ||||||   |||||| |||||||||||||||||    
1344432 accatatacatcattaaataaatgaacctaaaaagttaattttacttatatttaaagacgg 1344372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 7230135 - 7230195
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||| | || |||||||||||   |||||||||| |||||||| ||||    
7230135 accacatacatcattaattgaatgaacttaaaaaatcaattttgcttgtatttaaaaacgg 7230195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 12568513 - 12568565
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| |  |||| ||||||  |||||||||||||||||    
12568513 accacatacatcattaaatgagtgaacctaaaaagtaaattttgcttatattt 12568565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 13911354 - 13911406
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
13911354 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 13911406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 15401874 - 15401934
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||| ||||||| || |||| ||||||   ||||||||||||||||||| ||||    
15401874 accacatacattattaaataaatgaacctaaaaaattaattttgcttatatttaaaaacgg 15401934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 15998275 - 15998223
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||  ||||||  |||||||||||||||||    
15998275 accacatacatcattaaatgaatgaatctaaaaagtaaattttgcttatattt 15998223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 22954848 - 22954900
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
22954848 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 22954900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 26856037 - 26855977
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||| ||||||| || ||||||||||    |||||| |||||||||||||||||    
26856037 accacatacattattaaataaatgaacttaaaaggtcaatttttcttatatttaaagacgg 26855977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 546 - 602
Target Start/End: Complemental strand, 27146086 - 27146030
Alignment:
546 cacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagac 602  Q
    ||||||||||||||||| || |||| |||| |   ||||||||||||||||||||||    
27146086 cacatacatcattaaatgaatgaacctaaacagtcaattttgcttatatttaaagac 27146030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 34333015 - 34332959
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||||||||||   ||||||| |||||||||    
34333015 tgaaccacatacatcattaattgaatgaacttaaaaagtcaattttgtttatattta 34332959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 42468919 - 42468971
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
42468919 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 42468971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 43147511 - 43147563
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
43147511 accacatacatcattaaatgaatgaacataaaaagtgaattttgcttatattt 43147563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 44371258 - 44371310
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
44371258 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 44371310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 21)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 13902087 - 13902027
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| |||| ||||||   ||||||||||||||||||| ||||    
13902087 accacatacatcattaaattaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 13902027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 2693729 - 2693666
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||| ||||||   |||||| |||||||||||||||||    
2693729 tgaaccacatacatcattaaataaatgaacctaaaaagtcaattttacttatatttaaagacgg 2693666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 12588833 - 12588778
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
12588833 tgaaccacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattt 12588778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 544 - 597
Target Start/End: Original strand, 7418951 - 7419004
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||| |||| |||||||||||  ||| ||||||||||||||    
7418951 accacatacatcattaatttaatgaacttaaaaaataaaatttgcttatattta 7419004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Original strand, 2693738 - 2693798
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||| ||||||  | |||||||||||||||||| ||||    
2693738 accacatacatcattaaatgaatgaacctaaaaagtagattttgcttatatttaaaaacgg 2693798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 13740265 - 13740209
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| | |||| | |||||||||||||||||    
13740265 tgaaccacatacatcattaaatgaatgaaccttaaaaaacaattttgcttatattta 13740209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 13745765 - 13745709
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||||| || |||| | |||| | |||||||||||||||||    
13745765 tgaaccacatacatcattaaatgaatgaaccttaaaaaacaattttgcttatattta 13745709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 14897114 - 14897059
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
14897114 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 14897059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 25371071 - 25371016
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||||||||||   ||||||| ||||||||    
25371071 tgaaccacatacatcattaaatgaatgaacttaaaaagtgaattttgtttatattt 25371016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 28034082 - 28034027
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
28034082 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 28034027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 32364083 - 32364020
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || ||| |||||||   ||||||| ||||||||||| ||||    
32364083 tgaaccacatacatcattaaatgaatgaatttaaaaagtcaattttgtttatatttaaaaacgg 32364020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Complemental strand, 383672 - 383619
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
383672 aaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 383619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 596
Target Start/End: Complemental strand, 24914405 - 24914352
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
24914405 aaccacatacatcattaaataaatgaacctaaaaagtgaattttgcttatattt 24914352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 541 - 594
Target Start/End: Original strand, 30507072 - 30507125
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatat 594  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||    
30507072 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatat 30507125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 544 - 597
Target Start/End: Original strand, 31759400 - 31759453
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    ||||||||||||||||| | || |||||||||||   |||||||||||||||||    
31759400 accacatacatcattaattgaatgaacttaaaaagtcaattttgcttatattta 31759453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 2157633 - 2157685
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
2157633 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 2157685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 7418942 - 7418886
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattta 597  Q
    |||||||||||||||||||| | || |||| ||||||  ||| ||||||||||||||    
7418942 tgaaccacatacatcattaattgaatgaacctaaaaagtaaaatttgcttatattta 7418886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Complemental strand, 10118682 - 10118630
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
10118682 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 10118630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 25371080 - 25371132
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
25371080 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 25371132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 26597241 - 26597293
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
26597241 accacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 26597293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 548 - 604
Target Start/End: Complemental strand, 32436326 - 32436270
Alignment:
548 catacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||| || |||| |||||| | |||||| |||||||||||| ||||    
32436326 catacatcattaaatgaatgaacctaaaaaaacaattttacttatatttaaaaacgg 32436270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0321 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: scaffold0321
Description:

Target: scaffold0321; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 1700 - 1645
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
1700 tgaaccacatacatcattaaatgaatgaacctaaaaaataaattttgcttatattt 1645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0321; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 596
Target Start/End: Original strand, 1709 - 1761
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    ||||||||||||||||||| || |||| ||||||  |||||||||||||||||    
1709 accacatacatcattaaatgaatgaacctaaaaagtaaattttgcttatattt 1761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 10160 - 10223
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||  ||||||   ||||||||||||||||||||||||    
10160 tgaaccacatacatcattaaatgaatgaatctaaaaaattaattttgcttatatttaaagacgg 10223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Original strand, 17897 - 17960
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||  ||||||   ||||||||||||||||||||||||    
17897 tgaaccacatacatcattaaatgaatgaatctaaaaaattaattttgcttatatttaaagacgg 17960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 65987 - 65924
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||||| || |||  ||||||  |||||||||||||||||||| ||||    
65987 tgaaccacatacatcattaaatgaatgaatctaaaaagtaaattttgcttatatttaaatacgg 65924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0121 (Bit Score: 34; Significance: 0.0000000009; HSPs: 2)
Name: scaffold0121
Description:

Target: scaffold0121; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 604
Target Start/End: Original strand, 17509 - 17570
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    |||||||||||||||||||| || |||| ||||||   ||||||||||||||||||| ||||    
17509 aaccacatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaaaacgg 17570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0121; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 544 - 604
Target Start/End: Complemental strand, 17498 - 17438
Alignment:
544 accacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaagacgg 604  Q
    ||||||||||||||||||| || |||||||||||   | ||||||||||||||||| ||||    
17498 accacatacatcattaaatgaatgaacttaaaaaattatttttgcttatatttaaaaacgg 17438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0200 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 22375 - 22430
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
22375 tgaaccacatacatcattaaataaatgaacctaaaaagtgaattttgcttatattt 22430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 7041 - 7096
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||| ||| || |||| ||||||  |||||||||||||||||    
7041 tgaaccacatacatcattgaataaatgaacctaaaaaataaattttgcttatattt 7096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Original strand, 36483 - 36538
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || |||| ||||||   ||||||||||||||||    
36483 tgaaccacatacatcattaaatgaatgaacctaaaaagtgaattttgcttatattt 36538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 491917 - 491862
Alignment:
541 tgaaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatattt 596  Q
    |||||||||||||||||||||| || ||| |||||||   ||||||||||||||||    
491917 tgaaccacatacatcattaaatgaatgaatttaaaaaatgaattttgcttatattt 491862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0136 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0136
Description:

Target: scaffold0136; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 543 - 599
Target Start/End: Original strand, 22519 - 22575
Alignment:
543 aaccacatacatcattaaattaacgaacttaaaaacaaaattttgcttatatttaaa 599  Q
    ||||| |||||||||||||| || |||| ||||||   |||||||||||||||||||    
22519 aaccatatacatcattaaatgaatgaacctaaaaagtcaattttgcttatatttaaa 22575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126400 times since January 2019
Visitors: 1390