View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-3 (Length: 298)

Name: NF0095-INSERTION-3
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095-INSERTION-3
NF0095-INSERTION-3
[»] chr1 (2 HSPs)
chr1 (1-156)||(28957640-28957795)
chr1 (214-296)||(28957854-28957936)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 28957640 - 28957795
Alignment:
1 acttatgattattttcaaccagagattaaacttgagtactcttga-ttacaagattttaactgatgtatccttnnnnnnnnnnnngattttaactgatgt 99  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||            ||||||||||||| |    
28957640 acttatgattattttcaaccaaagattaaacttgagtactcttgatttacaagattttaacttatgtatcctt-aaaaaaaaaaagattttaactgatat 28957738  T
100 tcaaagttcaattagcaaacnnnnnnnaaaagcaacaaagataacatttattgaagg 156  Q
    ||||||||||||||||||||       |||||||||||| |||||||||||||||||    
28957739 tcaaagttcaattagcaaactttttttaaaagcaacaaaaataacatttattgaagg 28957795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 28957854 - 28957936
Alignment:
214 gatgggagaactgttaacacaaatcaaaaagcgcctctaatatgaaggtaaattctaaggtgccctcaagtttagaagggatt 296  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||    
28957854 gatgggagaactgttaacacaaatcaaaaagcgcttctaatatgaaggtaaattcaaaggtgccctcaagtttcgaagggatt 28957936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151127 times since January 2019
Visitors: 1526