View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-4 (Length: 135)

Name: NF0095-INSERTION-4
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095-INSERTION-4
[»] chr4 (1 HSPs)
chr4 (1-125)||(11415035-11415159)

Alignment Details
Target: chr4 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 11415035 - 11415159
1 agtaaccgctactttccgtatnnnnnnnntcaaccactannnnnnnagtagggaaagaaaaaataatcaaccactactaacagtatctaagatattttaa 100  Q
    |||||||||||||||||||||        ||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11415035 agtaaccgctactttccgtataaaaaaaatcaaccactatttttttagtagggaaagaaaaaataatcaaccactactaacagtatctaagatattttaa 11415134  T
101 tctatatgataaattctattatatt 125  Q
    |||||||||||| ||||||||||||    
11415135 tctatatgataagttctattatatt 11415159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125497 times since January 2019
Visitors: 1390