View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-5 (Length: 641)

Name: NF0095-INSERTION-5
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095-INSERTION-5
NF0095-INSERTION-5
[»] chr4 (2 HSPs)
chr4 (12-641)||(24224198-24224828)
chr4 (453-546)||(11096893-11096986)
[»] chr7 (1 HSPs)
chr7 (527-637)||(17927761-17927870)
[»] chr6 (4 HSPs)
chr6 (526-636)||(10740746-10740855)
chr6 (524-640)||(9401768-9401883)
chr6 (577-637)||(13166651-13166710)
chr6 (516-559)||(3950609-3950652)
[»] chr2 (1 HSPs)
chr2 (460-527)||(42631524-42631591)
[»] chr3 (1 HSPs)
chr3 (451-495)||(814352-814396)
[»] chr5 (1 HSPs)
chr5 (468-534)||(17749814-17749880)
[»] chr8 (1 HSPs)
chr8 (499-600)||(24725780-24725881)


Alignment Details
Target: chr4 (Bit Score: 445; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 12 - 641
Target Start/End: Original strand, 24224198 - 24224828
Alignment:
12 taataatagttgataacaatatgtttttgtgtaatttatacagtatgctaatatattatctccaccgaatttgtctcttctaaatgagctttcacttcat 111  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24224198 taataatatttgataacaatatgtttttgtgtaatttatacagtatgctaatatattatctccaccgaatttgtctcttctaaatgagctttcacttcat 24224297  T
112 ataatatctataaattacaccagaannnnnnnaacataattaagtataaaaaagtcatttttaccttcttttcctatcaagttgagctttcatgtttaaa 211  Q
    ||||||||||||||||||| |||||       |||||||||||||||||||||||||  |||||||||||||||||||||||||| ||||||||||||||    
24224298 ataatatctataaattacaacagaatttttttaacataattaagtataaaaaagtca--tttaccttcttttcctatcaagttgatctttcatgtttaaa 24224395  T
212 aaagtaaataatgttggaacgatttattacaaccattcaaaataaatatcatattcaattcatcaacgtgacatat---aannnnnnnnnnnnnaaactg 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||   |              |||| |    
24224396 aaagtaaataatgttggaacgatttattacaaccattcaaaataaatatcatattcaattcatcaatgtgacatatataattttttttcttcttaaaccg 24224495  T
309 acctaaatggaatatattaccacaaaagattctccccaatacaaagagcgcacatgaagaaatccgagcgcattaagatacataagnnnnnnnnnnnnnt 408  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||             |    
24224496 accaaaatggaatatattaccacaaaagattctccccaatacaaagagcgcacatgaagaaatccgagtgcattaagatacataagaaaaacaaaaaaat 24224595  T
409 atagaaaacttgagttagtagcttagctaatagataactcagtgttaagttattggtattctatgaaactctaactgtatttgttagtcactttgttatt 508  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||    
24224596 atagaaaacttgagtcagtagcttagctaatagataactgagtgttgagttattggtattctatgaaacgctaactgtatttgttagtcactttgttatt 24224695  T
509 ttatcttattatctatattgttaacatggtatccaaagcatgatttaatcctcattgaattgtttattgcttccgctattgagttcccaaaagtttaagg 608  Q
    |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||    
24224696 ttatcttattatctatattgttaacatggtattcaaagcatgatctaatcctcattgaattgtttatcgctttcgctattgagttcccaaaagtttaagg 24224795  T
609 aatgttgtgtgattgatttggtttaatttttaa 641  Q
    |||||||||||||||||||||||||||||||||    
24224796 aatgttgtgtgattgatttggtttaatttttaa 24224828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 453 - 546
Target Start/End: Original strand, 11096893 - 11096986
Alignment:
453 ttaagttattggtattctatgaaactctaactgtatttgttagtcactttgttattttatcttattatctatattgttaacatggtatccaaag 546  Q
    ||||| ||| |||||||||||||||||||||||| ||| |||||| |||||||||| | ||  |||| |||||||||||||||| |||| ||||    
11096893 ttaaggtataggtattctatgaaactctaactgtcttttttagtctctttgttattctctccgattagctatattgttaacatgatatctaaag 11096986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 3e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 527 - 637
Target Start/End: Complemental strand, 17927870 - 17927761
Alignment:
527 tgttaacatggtatccaaagcatgatttaatcctcattgaattgtttattgcttccgctattgagttcccaaaagtttaaggaatgttgtgtgattgatt 626  Q
    |||||||||||||| || |||||| ||| ||| || || |||||||| | |||||||||||||||||  |||||||||  ||||||||||||||||||||    
17927870 tgttaacatggtatacagagcatggtttgatcgtctttaaattgtttgtagcttccgctattgagttttcaaaagttt-gggaatgttgtgtgattgatt 17927772  T
627 tggtttaattt 637  Q
    |||||||||||    
17927771 tggtttaattt 17927761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 7e-20; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 526 - 636
Target Start/End: Original strand, 10740746 - 10740855
Alignment:
526 ttgttaacatggtatccaaagcatgatttaatcctcattgaattgtttattgcttccgctattgagttcccaaaagtttaaggaatgttgtgtgattgat 625  Q
    |||||||||||||||| | |||||| ||| |||||| ||||||  | | | ||||||||  ||||||||||||||||||  |||||||||||||||||||    
10740746 ttgttaacatggtatcaagagcatggtttgatcctccttgaatgatctgtcgcttccgcagttgagttcccaaaagtttg-ggaatgttgtgtgattgat 10740844  T
626 ttggtttaatt 636  Q
    |||||||||||    
10740845 ttggtttaatt 10740855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 524 - 640
Target Start/End: Original strand, 9401768 - 9401883
Alignment:
524 tattgttaacatggtatccaaagcatgatttaatcctcattgaattgtttattgcttccgctattgagttcccaaaagtttaaggaatgttgtgtgattg 623  Q
    |||||||||||||||||| | | | || | | |||||| ||||| | ||| |  |||||| | |||||||||||||| |||  ||||| |||||||||||    
9401768 tattgttaacatggtatcgagaacttgttctgatcctccttgaactatttgtctcttccgttgttgagttcccaaaaatttg-ggaatattgtgtgattg 9401866  T
624 atttggtttaattttta 640  Q
    ||||||||| |||||||    
9401867 atttggtttgattttta 9401883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 577 - 637
Target Start/End: Original strand, 13166651 - 13166710
Alignment:
577 gcttccgctattgagttcccaaaagtttaaggaatgttgtgtgattgatttggtttaattt 637  Q
    ||||||||| ||| |||||||||| |||  ||||| |||||||||||||||||||||||||    
13166651 gcttccgcttttgtgttcccaaaaatttg-ggaattttgtgtgattgatttggtttaattt 13166710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 516 - 559
Target Start/End: Original strand, 3950609 - 3950652
Alignment:
516 attatctatattgttaacatggtatccaaagcatgatttaatcc 559  Q
    |||||||||||||||||||||||||| |||||||| ||| ||||    
3950609 attatctatattgttaacatggtatcgaaagcatggtttgatcc 3950652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 460 - 527
Target Start/End: Complemental strand, 42631591 - 42631524
Alignment:
460 attggtattctatgaaactctaactgtatttgttagtcactttgttattttatcttattatctatatt 527  Q
    |||| ||||||||||||||||||| || |||||||||| |||||||||| ||||| ||||||||||||    
42631591 attgatattctatgaaactctaacagtttttgttagtctctttgttattctatctgattatctatatt 42631524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 451 - 495
Target Start/End: Complemental strand, 814396 - 814352
Alignment:
451 tgttaagttattggtattctatgaaactctaactgtatttgttag 495  Q
    ||||||| ||||||||||||||||||||||| |||| ||||||||    
814396 tgttaagctattggtattctatgaaactctagctgtctttgttag 814352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 468 - 534
Target Start/End: Original strand, 17749814 - 17749880
Alignment:
468 tctatgaaactctaactgtatttgttagtcactttgttattttatcttattatctatattgttaaca 534  Q
    ||||||||||  |||| || |||||||||| |||| ||||| | ||| |||||||||||||||||||    
17749814 tctatgaaaccttaaccgtttttgttagtctctttattattctctctgattatctatattgttaaca 17749880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 499 - 600
Target Start/End: Original strand, 24725780 - 24725881
Alignment:
499 ctttgttattttatcttattatctatattgttaacatggtatccaaagcatgatttaatcctcattgaattgtttattgcttccgctattgagttcccaa 598  Q
    |||| ||||| ||||| ||||||||| ||||||||||| |||| | ||| | |||| ||| || ||||||  |||||  ||||| ||||||| |||||||    
24725780 ctttattattctatctgattatctatgttgttaacatgatatcaagagcctaatttgatcgtccttgaatcatttataacttcctctattgaattcccaa 24725879  T
599 aa 600  Q
    ||    
24725880 aa 24725881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150870 times since January 2019
Visitors: 1524