View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-7 (Length: 536)

Name: NF0095-INSERTION-7
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095-INSERTION-7
NF0095-INSERTION-7
[»] chr3 (1 HSPs)
chr3 (1-536)||(52646395-52646930)
[»] chr1 (2 HSPs)
chr1 (70-182)||(7345272-7345384)
chr1 (321-441)||(7345584-7345704)
[»] chr5 (1 HSPs)
chr5 (96-179)||(8141258-8141341)
[»] chr8 (1 HSPs)
chr8 (345-393)||(5452480-5452528)


Alignment Details
Target: chr3 (Bit Score: 520; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 520; E-Value: 0
Query Start/End: Original strand, 1 - 536
Target Start/End: Original strand, 52646395 - 52646930
Alignment:
1 gttttgatgtgaaaaaattatttctctttctagattgagaacgaatacggaccagagagcagggcaacaggagctgctggtcatgcatacctaaactggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52646395 gttttgatgtgaaaaaattatttctctttctagattgagaacgaatacggaccagagagcagggcaacaggagctgctggtcatgcatacctaaactggg 52646494  T
101 ctgcaaatatggctgttggattgggaacaggagtcccttgggtgatgtgcaaggaaaatgatgccccagatcctgtggtgagctctttcattctcttggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52646495 ctgcaaatatggctgttggattgggaacaggagtcccttgggtgatgtgcaaggaaaatgatgccccagatcctgtggtgagctctttcattctcttggt 52646594  T
201 taactcatttgcttcagctgtcacacttaagggcgattgattgagttcaagaattgaaattatcgagtctcaagctctatatttaggctcaccatcatta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52646595 taactcatttgcttcagctgtcacacttaagggcgattgattgagttcaagaattgaaattatcgagtctcaagctctatatttaggctcaccatcatta 52646694  T
301 tatacttattgagggttgaatatgatccatccaattctccactacagattaattcatgtaatggtttttactgtgatgatttctctccaaatacaccata 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
52646695 tatacttattgagggttgaatatgatccatccaattctccactacagattaattcatgtaatggtttttactgtgatgatttctctccaaataaaccata 52646794  T
401 taagcctagcatgtggactgagtcttggagtggctggtaagctatatattgttatgatgttagatataattgtttaatttcttcacccttttattcttct 500  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||    
52646795 taagcctagcatgtggaccgagtcttggagtggctggtaagctatatattgttctgatgttagatataattgtctaatttcttcacccttttattcttct 52646894  T
501 gatctctttctttctattctccatgatcataaggtt 536  Q
    ||||||||||||||||||||||||||||||||||||    
52646895 gatctctttctttctattctccatgatcataaggtt 52646930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 73; Significance: 4e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 70 - 182
Target Start/End: Original strand, 7345272 - 7345384
Alignment:
70 ggagctgctggtcatgcatacctaaactgggctgcaaatatggctgttggattgggaacaggagtcccttgggtgatgtgcaaggaaaatgatgccccag 169  Q
    |||||| ||||||||||||||  ||||||||||||||| |||||||||||||| || ||||| ||||||||||||||||| |||||| ||||||||||||    
7345272 ggagcttctggtcatgcatactcaaactgggctgcaaaaatggctgttggattaggtacaggtgtcccttgggtgatgtgtaaggaagatgatgccccag 7345371  T
170 atcctgtggtgag 182  Q
    |||| ||||||||    
7345372 atccagtggtgag 7345384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 441
Target Start/End: Original strand, 7345584 - 7345704
Alignment:
321 tatgatccatccaattctccactacagattaattcatgtaatggtttttactgtgatgatttctctccaaatacaccatataagcctagcatgtggactg 420  Q
    |||||||||||||||| |   |||||||| ||| | || ||||||||||||||||||||||||||||| |||| |||||| |||||||   | |||||||    
7345584 tatgatccatccaattttttcctacagataaatgcttgcaatggtttttactgtgatgatttctctcccaataaaccatacaagcctaaactatggactg 7345683  T
421 agtcttggagtggctggtaag 441  Q
    ||||||||||||| |||||||    
7345684 agtcttggagtggttggtaag 7345704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 96 - 179
Target Start/End: Complemental strand, 8141341 - 8141258
Alignment:
96 ctgggctgcaaatatggctgttggattgggaacaggagtcccttgggtgatgtgcaaggaaaatgatgccccagatcctgtggt 179  Q
    ||||||||| || |||||||||| | ||||||| || || || ||| | |||||||||||| ||||||| |||||||| |||||    
8141341 ctgggctgcgaaaatggctgttgaaatgggaactggggttccatggattatgtgcaaggaagatgatgctccagatccagtggt 8141258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 393
Target Start/End: Original strand, 5452480 - 5452528
Alignment:
345 cagattaattcatgtaatggtttttactgtgatgatttctctccaaata 393  Q
    ||||||||| | ||||||||||| || |||||| |||||||||||||||    
5452480 cagattaatacttgtaatggtttctattgtgattatttctctccaaata 5452528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150630 times since January 2019
Visitors: 1522