View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-8 (Length: 630)

Name: NF0095-INSERTION-8
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095-INSERTION-8
[»] chr4 (1 HSPs)
chr4 (1-85)||(12869607-12869691)

Alignment Details
Target: chr4 (Bit Score: 85; Significance: 3e-40; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 12869607 - 12869691
1 gtttgtatggttgtaattagatctcttcatctagccttatattttcactttattttctaatttaatatagtcatgcaagtgtttt 85  Q
12869607 gtttgtatggttgtaattagatctcttcatctagccttatattttcactttattttctaatttaatatagtcatgcaagtgtttt 12869691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150917 times since January 2019
Visitors: 1524