View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_1 (Length: 980)

Name: NF0095_high_1
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_1
[»] chr6 (4 HSPs)
chr6 (9-951)||(33701185-33702128)
chr6 (390-453)||(33714809-33714872)
chr6 (366-446)||(21136654-21136735)
chr6 (243-350)||(21311092-21311200)
[»] chr8 (2 HSPs)
chr8 (769-855)||(6094181-6094267)
chr8 (812-858)||(10920251-10920297)
[»] scaffold0076 (2 HSPs)
scaffold0076 (391-446)||(12757-12812)
scaffold0076 (266-347)||(12590-12672)
[»] scaffold0063 (1 HSPs)
scaffold0063 (769-855)||(5587-5673)
[»] chr1 (1 HSPs)
chr1 (801-855)||(21171328-21171382)
[»] scaffold0657 (1 HSPs)
scaffold0657 (810-855)||(1051-1096)
[»] scaffold0016 (1 HSPs)
scaffold0016 (429-466)||(47213-47250)
[»] chr5 (1 HSPs)
chr5 (778-855)||(17285804-17285881)
[»] chr4 (1 HSPs)
chr4 (810-855)||(26963698-26963743)
[»] chr2 (1 HSPs)
chr2 (716-745)||(19692575-19692604)

Alignment Details
Target: chr6 (Bit Score: 769; Significance: 0; HSPs: 4)
Name: chr6

Target: chr6; HSP #1
Raw Score: 769; E-Value: 0
Query Start/End: Original strand, 9 - 951
Target Start/End: Original strand, 33701185 - 33702128
9 gttttttctctttataccaagatgtatatcaaacattttcctttctattcaacaaaagaaaaaataaatttagaaactccattt----tagtagattgat 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||    
33701185 gttttttctctttataccaagatgtatatcaaacattttcctttctattcaacaaaagaaaaaataaatttagaaactccatttattttagtagattgat 33701284  T
105 cttcaaaaataccaacatatgaaaatttaaaatttagtttttccaaatgtcggatactttcgagaaccaatgcaccaaaagttattacataccataacca 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33701285 cttcaaaaataccaacatatgaaaatttaaaatttagtttttccaaatgtcggatactttcgagaaccaatgcaccaaaagttattacatactataacca 33701384  T
205 cttttataaactaagtggagatcgcataatatacatttcatttttgggtctaaacagttgcagcataagggtgttttataagtaaatcttcttattgttg 304  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||    
33701385 cttttataaactaagtggagatagcataatatacatttcatttttgggtctaaacagttgcagcacaagggtcttttataagtaaatcttcttatcgttg 33701484  T
305 tttaagcactattgatgtgggactgttcagaccaaaatccagagtgtacttcttcatcctcctcatgtttctagtgttttatatgtcttggtgtttagaa 404  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||    
33701485 tttaagcactattgatgtgggactgttcagaccaaaatccagagtatacttcttcgtcctgctcatgtttctagtgttttatatgtcttggtgtttagaa 33701584  T
405 tttctattctatagaattttgatcttgttaaattttggattaggatgggtttcgttgcatagattgtgactatagaaagagaaacgnnnnnnnnntatat 504  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||    
33701585 tttctattctatagaattttgatcttgttaaattttggattaggatgggtttcgttgcatagattgtgactatagaaagagaaacgaaaaaaaaaaatat 33701684  T
505 tgagaaagtctagtgttaaggaagatgaaaatgataaaaatgnnnnnnnagatgcacatgaaacaatttatataacttactacgtaatattatcatggtt 604  Q
    ||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||| ||||||||||||||||||||||||||||||||||    
33701685 tgagaaagtctagtgttaaggaagatgaaaatgataaaaatg-ttttttagatgcacatgaaacagtttatataacttactacgtaatattatcatggtt 33701783  T
605 agtcaatcttaatacttaaactcatctgaaagatctgttaactctttattatgattcgtgaaatttaatcattggtcttgtacatatataacaatctcta 704  Q
    ||||||||  |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| || | |||| |||||||| ||| ||    
33701784 agtcaatc-gaatacttaaactcacctgaaagatttgttaactctttattatgattcgtgaaatttaatcattgctc-tctacacatataacagtcttta 33701881  T
705 tgcagtataaatatctcatttcatagtaaaacttttgactatgtgttgtaccaaataaaacttctgactatagatacttcaaaaataatgtcattttgtt 804  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33701882 tgcagtataaatatctcatttcatagtaaaacttttgactatgggttgtaccaaataaaacttctgactatagatacttcaaaaataatgtcattttgtt 33701981  T
805 caacagggtctcacgattaaatcatatttaatgtttcattaaacggactaattaaatccctcaagttaacagaacaagttacattagatagatttgctaa 904  Q
    |||| |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33701982 caacggaatctcacgattaaatcatatttaatgtttcattaaacggactaattaaatccctcaagttaacagaacaagttacattagatagacttgctaa 33702081  T
905 taacctgatattatcatagcttgaacaattggaatacatgtcacatt 951  Q
33702082 taacctgatattatcatagcttgaacaattggaatacatgtcacatt 33702128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 390 - 453
Target Start/End: Original strand, 33714809 - 33714872
390 tcttggtgtttagaatttctattctatagaattttgatcttgttaaattttggattaggatggg 453  Q
    |||||||||| ||| |||||||||| ||||| |||||  |||||||||||| ||||||||||||    
33714809 tcttggtgttgagattttctattctttagaactttgaatttgttaaattttagattaggatggg 33714872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 446
Target Start/End: Original strand, 21136654 - 21136735
366 ctcatgtttctagt-gttttatatgtcttggtgtttagaatttctattctatagaattttgatcttgttaaattttggatta 446  Q
    ||||||||||| || |||| |||||| |||||||| ||||||| ||||||  |||| |||||  ||||||||||||||||||    
21136654 ctcatgtttctggttgtttgatatgtattggtgttgagaatttatattcttcagaactttgaatttgttaaattttggatta 21136735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 243 - 350
Target Start/End: Original strand, 21311092 - 21311200
243 catttttgggtctaaacagttgcagcataagggtgttttataagtaaatcttctt-attgttgtttaagcactattgatgtgggactgttcagaccaaaa 341  Q
    |||| |||||||||||| |||  |||| |||||  |||||||||||| |||||||  |||||| ||||| || ||  || |||||||||||| |||||||    
21311092 cattattgggtctaaactgttagagcacaagggccttttataagtaagtcttcttctttgttggttaagtaccatcaatatgggactgttcaaaccaaaa 21311191  T
342 tccagagtg 350  Q
    || ||||||    
21311192 tctagagtg 21311200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000004; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 769 - 855
Target Start/End: Complemental strand, 6094267 - 6094181
769 tgactatagatacttcaaaaataatgtcattttgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||| |||||||| ||||||| | || || |||| ||| ||||||||| ||||| | ||| |||||||| |||||||||||||||    
6094267 tgactacagatactttaaaaatagtttccttatgtttaacggggtctcacaattaagttatacttaatgttccattaaacggactaa 6094181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 812 - 858
Target Start/End: Complemental strand, 10920297 - 10920251
812 gtctcacgattaaatcatatttaatgtttcattaaacggactaatta 858  Q
    ||||||||||||| ||||| |||||||| |||||||| |||||||||    
10920297 gtctcacgattaactcatacttaatgttccattaaacagactaatta 10920251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 32; Significance: 0.00000002; HSPs: 2)
Name: scaffold0076

Target: scaffold0076; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 391 - 446
Target Start/End: Original strand, 12757 - 12812
391 cttggtgtttagaatttctattctatagaattttgatcttgttaaattttggatta 446  Q
    |||| |||| ||||||| |||||| ||||| ||||| |||||||||||||||||||    
12757 cttgatgttgagaatttgtattctttagaactttgaacttgttaaattttggatta 12812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076; HSP #2
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 266 - 347
Target Start/End: Original strand, 12590 - 12672
266 agcataagggtgttttataagtaaatcttcttattg-ttgtttaagcactattgatgtgggactgttcagaccaaaatccaga 347  Q
    |||| |||||| |||||||||||||||||| | ||| |||||||||||| ||  |||||||||| |||| |  ||||||||||    
12590 agcacaagggtcttttataagtaaatcttcctcttgattgtttaagcaccatccatgtgggactattcaaataaaaatccaga 12672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: scaffold0063

Target: scaffold0063; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 769 - 855
Target Start/End: Complemental strand, 5673 - 5587
769 tgactatagatacttcaaaaataatgtcattttgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||| | |||||| || |||||| || || |||| ||| ||||||||| ||||| | ||| |||||||| |||||||||||||||    
5673 tgactacatatactttaagaataatttccttatgtttaacggggtctcacaattaagttatacttaatgttccattaaacggactaa 5587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 801 - 855
Target Start/End: Original strand, 21171328 - 21171382
801 tgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||||| ||||||||| ||||| | |||||||||||| ||| |||||||||||    
21171328 tgttcaacggggtctcacaattaagttatatttaatgttccatgaaacggactaa 21171382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0657 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0657

Target: scaffold0657; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 810 - 855
Target Start/End: Complemental strand, 1096 - 1051
810 gggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    ||||||||| ||||| | ||| ||||||||||||||||||||||||    
1096 gggtctcacaattaagttatacttaatgtttcattaaacggactaa 1051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0016

Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 429 - 466
Target Start/End: Complemental strand, 47250 - 47213
429 ttgttaaattttggattaggatgggtttcgttgcatag 466  Q
    |||||||||||||||||| ||||||||||||| |||||    
47250 ttgttaaattttggattaagatgggtttcgttacatag 47213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 778 - 855
Target Start/End: Original strand, 17285804 - 17285881
778 atacttcaaaaataatgtcattttgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||| || ||||||||||||| ||| |  ||||| |||||||||| ||| | |||||||| |||||||| ||||||    
17285804 atactttaagaataatgtcatttagtttactagggtttcacgattaagtcacacttaatgttccattaaacagactaa 17285881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 810 - 855
Target Start/End: Complemental strand, 26963743 - 26963698
810 gggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    ||||||||| ||||| | |||||||||||| |||||||||||||||    
26963743 gggtctcacaattaagttatatttaatgttccattaaacggactaa 26963698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Original strand, 19692575 - 19692604
716 tatctcatttcatagtaaaacttttgacta 745  Q
19692575 tatctcatttcatagtaaaacttttgacta 19692604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150593 times since January 2019
Visitors: 1522