View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_10 (Length: 479)

Name: NF0095_high_10
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_10
NF0095_high_10
[»] chr1 (14 HSPs)
chr1 (332-383)||(47411051-47411102)
chr1 (332-447)||(52181239-52181354)
chr1 (332-383)||(16218476-16218527)
chr1 (332-383)||(36511329-36511380)
chr1 (332-383)||(16217507-16217558)
chr1 (332-383)||(25787162-25787213)
chr1 (332-383)||(26056145-26056196)
chr1 (332-383)||(47136685-47136736)
chr1 (332-382)||(13641324-13641374)
chr1 (332-383)||(19466203-19466254)
chr1 (332-383)||(25786035-25786086)
chr1 (293-340)||(52439355-52439406)
chr1 (330-383)||(14764294-14764347)
chr1 (332-372)||(14169686-14169726)
[»] chr7 (9 HSPs)
chr7 (295-377)||(35128195-35128281)
chr7 (330-383)||(43936138-43936191)
chr7 (332-383)||(14206740-14206791)
chr7 (332-383)||(14215430-14215481)
chr7 (332-383)||(22061793-22061844)
chr7 (332-382)||(22744813-22744863)
chr7 (332-382)||(35127877-35127927)
chr7 (333-382)||(46674933-46674982)
chr7 (330-383)||(47163218-47163271)
[»] chr3 (16 HSPs)
chr3 (330-383)||(2124094-2124147)
chr3 (332-383)||(25585831-25585882)
chr3 (332-444)||(51825558-51825670)
chr3 (336-383)||(53808389-53808436)
chr3 (332-447)||(42632773-42632888)
chr3 (332-447)||(42633820-42633935)
chr3 (332-382)||(47808105-47808155)
chr3 (330-366)||(13077966-13078002)
chr3 (400-447)||(9776991-9777038)
chr3 (332-383)||(11219497-11219548)
chr3 (332-383)||(29536781-29536832)
chr3 (332-383)||(32980450-32980501)
chr3 (332-383)||(54653964-54654015)
chr3 (332-374)||(35173214-35173256)
chr3 (290-340)||(14206850-14206904)
chr3 (290-340)||(14214598-14214652)
[»] chr5 (10 HSPs)
chr5 (293-382)||(10084622-10084715)
chr5 (330-382)||(38473554-38473606)
chr5 (332-383)||(15857616-15857667)
chr5 (392-443)||(36206997-36207048)
chr5 (330-383)||(32734196-32734249)
chr5 (332-382)||(8762399-8762449)
chr5 (332-382)||(26403374-26403424)
chr5 (334-383)||(22819515-22819564)
chr5 (330-382)||(1663252-1663304)
chr5 (335-383)||(40058088-40058136)
[»] chr8 (16 HSPs)
chr8 (336-383)||(36756135-36756182)
chr8 (328-383)||(13367048-13367103)
chr8 (332-383)||(35943975-35944026)
chr8 (332-382)||(36940032-36940082)
chr8 (296-382)||(36938708-36938798)
chr8 (332-381)||(38589887-38589936)
chr8 (332-383)||(1570204-1570255)
chr8 (332-383)||(27750619-27750670)
chr8 (342-380)||(4810125-4810163)
chr8 (332-374)||(20308672-20308714)
chr8 (332-374)||(21095305-21095347)
chr8 (332-382)||(31623973-31624023)
chr8 (332-382)||(31625383-31625433)
chr8 (291-346)||(36756057-36756116)
chr8 (332-378)||(38591010-38591056)
chr8 (332-380)||(43277922-43277970)
[»] chr4 (12 HSPs)
chr4 (332-383)||(5688635-5688686)
chr4 (332-383)||(34439658-34439709)
chr4 (332-383)||(38370349-38370400)
chr4 (332-383)||(38417620-38417671)
chr4 (332-382)||(5687242-5687292)
chr4 (332-383)||(1273431-1273482)
chr4 (328-383)||(3217607-3217662)
chr4 (332-383)||(6139064-6139115)
chr4 (332-383)||(33377362-33377413)
chr4 (330-372)||(10403344-10403386)
chr4 (332-382)||(33376285-33376335)
chr4 (332-372)||(55952892-55952932)
[»] chr2 (9 HSPs)
chr2 (332-383)||(15650508-15650559)
chr2 (332-383)||(4829532-4829583)
chr2 (332-383)||(12852953-12853004)
chr2 (332-383)||(40174762-40174813)
chr2 (328-382)||(14509272-14509326)
chr2 (332-383)||(3533624-3533675)
chr2 (392-443)||(15269030-15269081)
chr2 (328-383)||(23178880-23178935)
chr2 (328-383)||(23590137-23590192)
[»] scaffold0007 (1 HSPs)
scaffold0007 (330-382)||(145868-145920)
[»] chr6 (8 HSPs)
chr6 (330-382)||(14328773-14328825)
chr6 (330-382)||(14421783-14421835)
chr6 (332-382)||(8411153-8411203)
chr6 (394-444)||(9754257-9754307)
chr6 (332-382)||(22299902-22299952)
chr6 (332-383)||(8412314-8412365)
chr6 (332-381)||(293640-293689)
chr6 (332-372)||(5311346-5311386)
[»] scaffold2127 (1 HSPs)
scaffold2127 (332-383)||(513-564)
[»] scaffold0051 (1 HSPs)
scaffold0051 (332-382)||(22194-22244)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 47411051 - 47411102
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
47411051 aatttggtctcataaatcttatgtcgtttactattttggtcatctccgttag 47411102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 447
Target Start/End: Complemental strand, 52181354 - 52181239
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttagnnnnnnngcaaaaacggttaac-ctttgccacatgtcagttatgattg 430  Q
    ||||| |||||||||||||||||| |||||||||| |||||||||||||||        |||||| | |||||| ||||| ||||||||| ||| |||||    
52181354 aatttagtctcataaatcttatgttgtttactattttggtcatctccgtta-atattttgcaaaatctgttaactctttgtcacatgtcatttaagattg 52181256  T
431 gtgatcaaaggttggat 447  Q
    |||||||| ||||||||    
52181255 gtgatcaacggttggat 52181239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 16218527 - 16218476
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||||||||||||| |||| ||||||||||||||||    
16218527 aatttggtcccataaatcttatgtcgtttaatattttggtcatctccgttag 16218476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 36511380 - 36511329
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| |||||||||||||| ||||||||||||||||    
36511380 aatttggtcccataaatcttctgtcgtttactattttggtcatctccgttag 36511329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 16217507 - 16217558
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||  |||||||||||||| ||||||||| ||||||||||||||||    
16217507 aatttggtcctataaatcttatgtcatttactattttggtcatctccgttag 16217558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 25787213 - 25787162
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||||||||||||| | ||||||||| ||||| ||||||||||    
25787213 aatttggtctcataaatcttatgccatttactattttggtcctctccgttag 25787162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 26056196 - 26056145
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| |||||||||||||| ||||| ||||||||||    
26056196 aatttggtcccataaatcttttgtcgtttactattttggtcctctccgttag 26056145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 47136736 - 47136685
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||| |||||||||||||| ||||||||||| ||||| ||||||||||    
47136736 aatttggtgtcataaatcttatgccgtttactattttggtcctctccgttag 47136685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 13641324 - 13641374
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| |||||||||| || ||||||||||| |||||||||||||||    
13641324 aatttggtcccataaatcttctgccgtttactattttggtcatctccgtta 13641374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 19466254 - 19466203
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| |||||||||||||| ||||  ||||||||||    
19466254 aatttggtcccataaatcttctgtcgtttactattgtggttctctccgttag 19466203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 25786035 - 25786086
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||||||||||||| |||| ||||| |||| |||||    
25786035 aatttggtcccataaatcttatgtcgtttattattttggtcctctctgttag 25786086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 340
Target Start/End: Complemental strand, 52439406 - 52439355
Alignment:
293 ggcttaatacatcatttggtcc----acttattttctgtttttaatttggtc 340  Q
    ||||||||||||||||||||||    |||||||||||||||| |||||||||    
52439406 ggcttaatacatcatttggtcccttaacttattttctgttttcaatttggtc 52439355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 330 - 383
Target Start/End: Original strand, 14764294 - 14764347
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||||||| |||| ||||||||||| || | |||||||| |||||    
14764294 ttaatttggtctcataagtcttctgtcgtttactgttttagtcatctctgttag 14764347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 332 - 372
Target Start/End: Original strand, 14169686 - 14169726
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtc 372  Q
    ||||||||| |||||||||| |||||||||||||| |||||    
14169686 aatttggtcccataaatcttttgtcgtttactattttggtc 14169726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 377
Target Start/End: Complemental strand, 35128281 - 35128195
Alignment:
295 cttaatacatcatttggtcc----acttattttctgtttttaatttggtctcataaatcttatgtcgtttactattatggtcatctc 377  Q
    ||||||||||||||||||||    |||||||||  ||||| |||||||||  |||||||||||||||||||||||| ||||| ||||    
35128281 cttaatacatcatttggtcccttaacttatttttggttttcaatttggtcctataaatcttatgtcgtttactattttggtcctctc 35128195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 330 - 383
Target Start/End: Complemental strand, 43936191 - 43936138
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||||||| |||| |||||||||||||| ||||| ||||||||||    
43936191 ttaatttggtctcataattcttctgtcgtttactattttggtcctctccgttag 43936138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 14206740 - 14206791
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||  ||||||||| |||||||||||||| || |||||||||||||    
14206740 aatttggtcctataaatcttctgtcgtttactattttgctcatctccgttag 14206791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 14215430 - 14215481
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||  ||||||||| |||||||||||||| || |||||||||||||    
14215430 aatttggtcctataaatcttctgtcgtttactattttgctcatctccgttag 14215481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 22061844 - 22061793
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| ||||||||||||| ||||||||||| | ||| ||||||||||    
22061844 aatttggtcccataaatcttatgccgtttactattttagtcttctccgttag 22061793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 22744813 - 22744863
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||  |||||||||||| ||||||||||| ||||| |||||||||    
22744813 aatttggtcctataaatcttatgccgtttactattttggtcttctccgtta 22744863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 35127877 - 35127927
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||| ||| ||||||||||||| ||||||||||| ||||||||| |||||    
35127877 aattttgtcccataaatcttatgccgtttactattttggtcatcttcgtta 35127927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 382
Target Start/End: Complemental strand, 46674982 - 46674933
Alignment:
333 atttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||| |||||||||| || ||||||||||| ||||| |||||||||    
46674982 atttggtcccataaatcttttgccgtttactattttggtcctctccgtta 46674933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 330 - 383
Target Start/End: Original strand, 47163218 - 47163271
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||| |||||||||| |  ||||||||||| ||||| ||||||||||    
47163218 ttaatttggtcccataaatctttttccgtttactattttggtcctctccgttag 47163271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 16)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 330 - 383
Target Start/End: Original strand, 2124094 - 2124147
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||    
2124094 ttaatttggtcccataaatcttatgccgtttactattttggtcatctccgttag 2124147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 25585882 - 25585831
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||||||||||||| |||||||||||||| | ||||||||||||||    
25585882 aatttggtctcataaatcttctgtcgtttactattttagtcatctccgttag 25585831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 444
Target Start/End: Complemental strand, 51825670 - 51825558
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttagnnnnnnngcaaaaacggttaac-ctttgccacatgtcagttatgattg 430  Q
    ||||||||| |||||||||| |||||||||||||| ||||||| ||||||||       |||||| | |||||| |||| |||| ||||||||| |||||    
51825670 aatttggtcccataaatcttctgtcgtttactattttggtcatatccgttag-tattttgcaaaatctgttaactcttttccacgtgtcagttaagattg 51825572  T
431 gtgatcaaaggttg 444  Q
    |||||||| |||||    
51825571 gtgatcaatggttg 51825558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 383
Target Start/End: Original strand, 53808389 - 53808436
Alignment:
336 tggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||| ||||||||||||||||||||||||| ||||||||||| ||||    
53808389 tggtcccataaatcttatgtcgtttactattttggtcatctccattag 53808436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 447
Target Start/End: Original strand, 42632773 - 42632888
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttagnnnnnnngcaaaaacggttaac-ctttgccacatgtcagttatgattg 430  Q
    |||||| || ||||||||||||||||||||||||| | ||| ||||||||||       ||||||   |||||| ||||||||| ||||| ||| |||||    
42632773 aatttgatcccataaatcttatgtcgtttactattttagtcctctccgttag-tattttgcaaaatttgttaactctttgccacgtgtcatttaagattg 42632871  T
431 gtgatcaaaggttggat 447  Q
    |||||||| ||||||||    
42632872 gtgatcaacggttggat 42632888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 447
Target Start/End: Complemental strand, 42633935 - 42633820
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttagnnnnnnngcaaaaacggttaac-ctttgccacatgtcagttatgattg 430  Q
    ||||||||| |||||||||||||||||||| |||| ||||| |||| |||||       ||||||   |||||| ||||||||||||||| ||| |||||    
42633935 aatttggtcccataaatcttatgtcgtttattattttggtcctctctgttag-tatttggcaaaatttgttaactctttgccacatgtcatttaagattg 42633837  T
431 gtgatcaaaggttggat 447  Q
    || ||||| ||||||||    
42633836 gtaatcaacggttggat 42633820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 47808155 - 47808105
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||||||||||||| |||||||| ||||| ||||| |||||||||    
47808155 aatttggtctcataaatcttctgtcgtttgctattttggtcctctccgtta 47808105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 330 - 366
Target Start/End: Complemental strand, 13078002 - 13077966
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactatt 366  Q
    ||||||||||| |||||||||||||||||||||||||    
13078002 ttaatttggtcccataaatcttatgtcgtttactatt 13077966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 400 - 447
Target Start/End: Original strand, 9776991 - 9777038
Alignment:
400 gttaacctttgccacatgtcagttatgattggtgatcaaaggttggat 447  Q
    ||||||| ||||||||||||| ||| ||||| ||||||||||||||||    
9776991 gttaacccttgccacatgtcatttaggattgttgatcaaaggttggat 9777038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 11219497 - 11219548
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||| | |||| || ||||||||||| ||||||||||||||||    
11219497 aatttggtctcatgagtcttctgccgtttactattttggtcatctccgttag 11219548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 29536781 - 29536832
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| | |||||||||||| ||||| ||||||||||    
29536781 aatttggtcccataaatcttctttcgtttactattttggtcctctccgttag 29536832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 32980501 - 32980450
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||  ||||||||| || ||||||||||| ||||||||||||||||    
32980501 aatttggtcctataaatcttctgccgtttactattttggtcatctccgttag 32980450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 54654015 - 54653964
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| ||||| |||| |||||||||||||| ||||| ||||||||||    
54654015 aatttggtcccataattcttctgtcgtttactattttggtcctctccgttag 54653964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 374
Target Start/End: Original strand, 35173214 - 35173256
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcat 374  Q
    ||||||||||||||| |||| |||||||||||||| |||||||    
35173214 aatttggtctcataactcttttgtcgtttactattttggtcat 35173256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 290 - 340
Target Start/End: Complemental strand, 14206904 - 14206850
Alignment:
290 ttaggcttaatacatcatttggtcc----acttattttctgtttttaatttggtc 340  Q
    ||||||||||||||| |||||||||    | ||||||||||||||||||||||||    
14206904 ttaggcttaatacattatttggtcccttaatttattttctgtttttaatttggtc 14206850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 290 - 340
Target Start/End: Complemental strand, 14214652 - 14214598
Alignment:
290 ttaggcttaatacatcatttggtcc----acttattttctgtttttaatttggtc 340  Q
    ||||||||||||||| |||||||||    | ||||||||||||||||||||||||    
14214652 ttaggcttaatacattatttggtcccttaatttattttctgtttttaatttggtc 14214598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 293 - 382
Target Start/End: Original strand, 10084622 - 10084715
Alignment:
293 ggcttaatacatcatttggtcc----acttattttctgtttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||||||||||| |||    | |||||||  ||||| | |||||||||||||||||| |||||||||||||| ||||| |||||||||    
10084622 ggcttaatacatcatttgttcccttaatttatttttggttttcattttggtctcataaatcttttgtcgtttactattttggtcctctccgtta 10084715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 38473606 - 38473554
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||||| |||||||||| |||||||||||||| ||||||| |||||||    
38473606 ttaatttggtcccataaatcttctgtcgtttactattttggtcatttccgtta 38473554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 15857667 - 15857616
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||| || ||||||||||||||||||||| ||| ||||||||||||||||    
15857667 aatttgttcccataaatcttatgtcgtttaccattttggtcatctccgttag 15857616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 392 - 443
Target Start/End: Complemental strand, 36207048 - 36206997
Alignment:
392 caaaaacggttaacctttgccacatgtcagttatgattggtgatcaaaggtt 443  Q
    |||||||||||||| |||||||||| ||| ||||||||||||||||| ||||    
36207048 caaaaacggttaacttttgccacatatcatttatgattggtgatcaagggtt 36206997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 330 - 383
Target Start/End: Original strand, 32734196 - 32734249
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||| ||||| |||| |||||||||||||| ||||||| ||||||||    
32734196 ttaatttggtcccataactcttctgtcgtttactattttggtcatttccgttag 32734249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 8762449 - 8762399
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| ||||||| ||||||||||||||||| | ||| |||||||||    
8762449 aatttggtcacataaattttatgtcgtttactattttagtcctctccgtta 8762399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 26403374 - 26403424
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||| |||||||||| ||||||||||||||||| ||||| |||| ||||    
26403374 aatttgatctcataaattttatgtcgtttactattttggtcttctctgtta 26403424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 334 - 383
Target Start/End: Complemental strand, 22819564 - 22819515
Alignment:
334 tttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||| ||||| |||| || ||||||||||| ||||||||||||||||    
22819564 tttggtcccataactcttctgccgtttactattttggtcatctccgttag 22819515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 330 - 382
Target Start/End: Original strand, 1663252 - 1663304
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||||  ||||||||| || ||||||||||| ||||| |||||||||    
1663252 ttaatttggtcctataaatcttctgccgtttactattttggtcttctccgtta 1663304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 335 - 383
Target Start/End: Original strand, 40058088 - 40058136
Alignment:
335 ttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||||| |||| || ||||||| ||| ||||||||||||||||    
40058088 ttggtctcataactcttctgccgtttaccattttggtcatctccgttag 40058136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 16)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 336 - 383
Target Start/End: Original strand, 36756135 - 36756182
Alignment:
336 tggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||    
36756135 tggtcacataaatcttatgtcgtttactattttggtcatctccgttag 36756182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 13367103 - 13367048
Alignment:
328 ttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||| |||||||||| || ||||||||||| ||||| ||||||||||    
13367103 ttttaatttggtcccataaatcttctgccgtttactattttggtcctctccgttag 13367048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 35943975 - 35944026
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||||||  |||||||||| ||||||||||||||||    
35943975 aatttggtcccataaatcttatgcagtttactattttggtcatctccgttag 35944026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 36940082 - 36940032
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||| ||||||||||| || ||||||||||| |||||||||||||||    
36940082 aatttggtatcataaatcttctgccgtttactattttggtcatctccgtta 36940032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 296 - 382
Target Start/End: Original strand, 36938708 - 36938798
Alignment:
296 ttaatacatcatttggtcc----acttattttctgtttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||||||| ||||    |||||||||   |||||| |||||||||||||||||| || ||||||||||| ||||| |||| ||||    
36938708 ttaatacatcattttgtcctttaacttatttttgatttttactttggtctcataaatcttctgccgtttactattttggtcttctctgtta 36938798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 332 - 381
Target Start/End: Original strand, 38589887 - 38589936
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtt 381  Q
    ||||||||| ||||||||||||||||||||||||| || |||||| ||||    
38589887 aatttggtcccataaatcttatgtcgtttactattttgatcatcttcgtt 38589936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 1570255 - 1570204
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||  ||||| ||||| ||||||||||| ||||||||||||||||    
1570255 aatttggtctattaaattttatgccgtttactattttggtcatctccgttag 1570204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 27750670 - 27750619
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||||| | |||||||||| ||||| ||||||||||    
27750670 aatttggtcccataaatcttatattgtttactattttggtcttctccgttag 27750619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 380
Target Start/End: Complemental strand, 4810163 - 4810125
Alignment:
342 cataaatcttatgtcgtttactattatggtcatctccgt 380  Q
    ||||||||||||||| ||||||||| |||||||||||||    
4810163 cataaatcttatgtcatttactattttggtcatctccgt 4810125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 374
Target Start/End: Original strand, 20308672 - 20308714
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcat 374  Q
    ||||||||||||||| |||| |||||||||||||| |||||||    
20308672 aatttggtctcataactcttctgtcgtttactattttggtcat 20308714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 374
Target Start/End: Original strand, 21095305 - 21095347
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcat 374  Q
    ||||||||||||||| |||| |||||||||||||| |||||||    
21095305 aatttggtctcataactcttctgtcgtttactattttggtcat 21095347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 31623973 - 31624023
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| |||||||||||||||||||| |||| | ||| |||||||||    
31623973 aatttggtcccataaatcttatgtcgtttattattttagtcctctccgtta 31624023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 31625433 - 31625383
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| |||||||||| || ||||||||||| ||||| |||||||||    
31625433 aatttggtcccataaatcttttgccgtttactattttggtcctctccgtta 31625383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 346
Target Start/End: Original strand, 36756057 - 36756116
Alignment:
291 taggcttaatacatcatttggtcc----acttattttctgtttttaatttggtctcataa 346  Q
    ||||||||||||||||||||||||    |||||||||  ||||||||||||||| |||||    
36756057 taggcttaatacatcatttggtcccttaacttatttttagtttttaatttggtcccataa 36756116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 378
Target Start/End: Complemental strand, 38591056 - 38591010
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctcc 378  Q
    ||||||||| ||||||||||||| ||||||||||| ||||| |||||    
38591056 aatttggtcccataaatcttatgccgtttactattttggtcctctcc 38591010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 332 - 380
Target Start/End: Complemental strand, 43277970 - 43277922
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgt 380  Q
    ||||||||| | ||||||||||| ||||||||||| ||||||| |||||    
43277970 aatttggtcccgtaaatcttatgccgtttactattttggtcatgtccgt 43277922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 5688686 - 5688635
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||  ||||||||||||||||||||||||| ||||||||||||||||    
5688686 aatttggttccataaatcttatgtcgtttactattttggtcatctccgttag 5688635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 34439709 - 34439658
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| || ||||||||||| ||||||||||||||||    
34439709 aatttggtcccataaatcttctgccgtttactattttggtcatctccgttag 34439658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 38370349 - 38370400
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||||| |||| |||||||||| ||| ||||||||||||||||    
38370349 aatttggtctcataactcttctgtcgtttaccattttggtcatctccgttag 38370400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 38417620 - 38417671
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||||||||||||||||||  |||| ||||||||||    
38417620 aatttggtcccataaatcttatgtcgtttactatttcggtcctctccgttag 38417671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 5687242 - 5687292
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| |||||||||| || ||||||||||| |||||||||||||||    
5687242 aatttggtcccataaatcttttgccgtttactattttggtcatctccgtta 5687292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 1273482 - 1273431
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| ||||| ||||||||||||| ||||| ||||| ||||||||||    
1273482 aatttggtcccataagtcttatgtcgtttgctattttggtcctctccgttag 1273431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 3217662 - 3217607
Alignment:
328 ttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||| ||||||||||||| ||| |||||||||| ||||| | ||||||||    
3217662 ttttaatttgatctcataaatcttctgttgtttactattttggtcctatccgttag 3217607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 6139064 - 6139115
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||||||||| |||||||| ||||| |||| |||||||||| |||||    
6139064 aatttggtctcataactcttatgttgtttattattttggtcatctctgttag 6139115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 33377413 - 33377362
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| || ||||||||||| ||||| ||||||||||    
33377413 aatttggtcccataaatcttctgccgtttactattttggtcctctccgttag 33377362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 330 - 372
Target Start/End: Original strand, 10403344 - 10403386
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtc 372  Q
    ||||||||||||| ||||||||| ||||||||||||| |||||    
10403344 ttaatttggtctcgtaaatcttacgtcgtttactattttggtc 10403386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 33376285 - 33376335
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| |||||||||| |||||||||||||| | ||| |||||||||    
33376285 aatttggtcccataaatcttctgtcgtttactattttagtcctctccgtta 33376335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 332 - 372
Target Start/End: Original strand, 55952892 - 55952932
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtc 372  Q
    ||||||||||||||| |||||||||||||| |||| |||||    
55952892 aatttggtctcataactcttatgtcgtttattattttggtc 55952932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 15650508 - 15650559
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||| || ||||||||||||||||||||||| ||||||||||||||||    
15650508 aatttggtatcttaaatcttatgtcgtttactattttggtcatctccgttag 15650559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 4829532 - 4829583
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||| |||||||||||||||||||||||||||| ||||| |||| |||||    
4829532 aatttgatctcataaatcttatgtcgtttactattttggtcctctctgttag 4829583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Original strand, 12852953 - 12853004
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| | |||||||||||| ||||||||||||||||    
12852953 aatttggtcccataaatcttctatcgtttactattttggtcatctccgttag 12853004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 40174813 - 40174762
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| ||| |||||||||| ||||||||||||||||    
40174813 aatttggtcccataaatcttctgttgtttactattttggtcatctccgttag 40174762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 14509272 - 14509326
Alignment:
328 ttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||| |||| |||||||||| |||||||||||||| ||||| |||||||||    
14509272 ttttaattcggtcccataaatcttctgtcgtttactattttggtcctctccgtta 14509326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 3533675 - 3533624
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||||||||||||||| ||||||||||||||  | |||| ||||||||    
3533675 aatttggtctcataaatcttttgtcgtttactatttcgatcatttccgttag 3533624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 392 - 443
Target Start/End: Complemental strand, 15269081 - 15269030
Alignment:
392 caaaaacggttaacctttgccacatgtcagttatgattggtgatcaaaggtt 443  Q
    ||||||| ||||||  ||||||||||||| ||||||||||||||||| ||||    
15269081 caaaaaccgttaactcttgccacatgtcatttatgattggtgatcaagggtt 15269030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 23178935 - 23178880
Alignment:
328 ttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||| |||||| ||||||||||  |||||||| |||| ||||||||||||||||    
23178935 ttttaaattggtcccataaatcttcagtcgtttattattttggtcatctccgttag 23178880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 23590192 - 23590137
Alignment:
328 ttttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||| |||||| ||||||||||  |||||||| |||| ||||||||||||||||    
23590192 ttttaaattggtcccataaatcttcagtcgtttattattttggtcatctccgttag 23590137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 145920 - 145868
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||||  |||||||||||| ||||||||||| |||||||||||||||    
145920 ttaatttggtccaataaatcttatgccgtttactattttggtcatctccgtta 145868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 14328825 - 14328773
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||||||||||| |||| |||||||||||||| ||||| |||||||||    
14328825 ttaatttggtctcataattcttttgtcgtttactattttggtcctctccgtta 14328773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 14421835 - 14421783
Alignment:
330 ttaatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||||||||||| |||| |||||||||||||| ||||| |||||||||    
14421835 ttaatttggtctcataattcttttgtcgtttactattttggtcctctccgtta 14421783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 8411153 - 8411203
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||||||| |||||||||||| ||||||||||| ||||| |||||||||    
8411153 aatttggtcttataaatcttatgccgtttactattttggtcctctccgtta 8411203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 9754307 - 9754257
Alignment:
394 aaaacggttaacctttgccacatgtcagttatgattggtgatcaaaggttg 444  Q
    ||||| ||||||||||||||||||||| ||| ||||||||||||| |||||    
9754307 aaaactgttaacctttgccacatgtcacttaggattggtgatcaagggttg 9754257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 22299952 - 22299902
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    ||||||||| |||||||||| || ||||||||||| |||||||||||||||    
22299952 aatttggtcccataaatcttctgccgtttactattttggtcatctccgtta 22299902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 8412365 - 8412314
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    ||||||||| |||||||||| || ||||||||||| ||||| ||||||||||    
8412365 aatttggtcccataaatcttgtgccgtttactattttggtcctctccgttag 8412314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 381
Target Start/End: Complemental strand, 293689 - 293640
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtt 381  Q
    ||||||||||||||| |||| |||||||||| ||| ||||| ||||||||    
293689 aatttggtctcataagtcttctgtcgtttaccattttggtcctctccgtt 293640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 332 - 372
Target Start/End: Original strand, 5311346 - 5311386
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtc 372  Q
    |||||||||  |||||||||||||||||||||||| |||||    
5311346 aatttggtcctataaatcttatgtcgtttactattttggtc 5311386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold2127 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold2127
Description:

Target: scaffold2127; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 564 - 513
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgttag 383  Q
    |||||||| |||||||||||||| ||||||||||| ||||| ||||||||||    
564 aatttggtgtcataaatcttatgccgtttactattttggtcctctccgttag 513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 22194 - 22244
Alignment:
332 aatttggtctcataaatcttatgtcgtttactattatggtcatctccgtta 382  Q
    |||||| || |||||||||| |||||||||||||| |||||||||||||||    
22194 aatttgttcacataaatcttctgtcgtttactattttggtcatctccgtta 22244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126530 times since January 2019
Visitors: 1391