View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_12 (Length: 472)

Name: NF0095_high_12
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_12
NF0095_high_12
[»] chr7 (2 HSPs)
chr7 (11-443)||(38937390-38937822)
chr7 (11-396)||(39305177-39305562)


Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 11 - 443
Target Start/End: Original strand, 38937390 - 38937822
Alignment:
11 cagagaaatggtttcctgaaaggtctaactctgtcatttcctttaagtttccaaactcttcaggaatgggaccggagaaaagatttttgtagagaaaaag 110  Q
    ||||||| ||||||||||||||||||||| |||||||| |||| |||||||| | ||| ||||| || ||||| || || | ||| ||||| ||||  |     
38937390 cagagaagtggtttcctgaaaggtctaaccctgtcattaccttcaagtttcctatctcatcagggattggaccagacaacatattattgtacagaagtaa 38937489  T
111 aattttaannnnnnncaacaagccaatttgtggaggaatcattcctgttaacctannnnnnnggagttgcaaagaagttaactcagtccaattagagatc 210  Q
     ||| |||       ||  |||||||| |||||||| | | |||| ||||| |||       |||||||||| ||||||||||  ||||||||||| | |    
38937490 gattataatttttttcagtaagccaatctgtggaggtagctttccagttaaactattgttttggagttgcaaggaagttaacttggtccaattagatacc 38937589  T
211 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38937590 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 38937689  T
311 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgagatcaagatgcaccaa 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
38937690 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgagatcaagatgcactaa 38937789  T
411 ctcctttagttgacctatggaagaaggaatttc 443  Q
    |||||||||||||||||||||||||||||||||    
38937790 ctcctttagttgacctatggaagaaggaatttc 38937822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 396
Target Start/End: Complemental strand, 39305562 - 39305177
Alignment:
11 cagagaaatggtttcctgaaaggtctaactctgtcatttcctttaagtttccaaactcttcaggaatgggaccggagaaaagatttttgtagagaaaaag 110  Q
    ||||||| ||||||||||||||||||||| |||||||| |||| |||||||| | ||| ||||| || ||||| || || | ||| ||||| ||||  |     
39305562 cagagaagtggtttcctgaaaggtctaaccctgtcattaccttcaagtttcctatctcatcagggattggaccagacaacatattattgtacagaagtaa 39305463  T
111 aattttaannnnnnncaacaagccaatttgtggaggaatcattcctgttaacctannnnnnnggagttgcaaagaagttaactcagtccaattagagatc 210  Q
     ||| |||       ||  |||||||| |||||||| | | |||| ||||| |||       |||||||||| ||||||||||  ||||||||||| | |    
39305462 gattataatttttttcagtaagccaatctgtggaggtagctttccagttaaactattgttttggagttgcaaggaagttaacttggtccaattagatacc 39305363  T
211 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39305362 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 39305263  T
311 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgaga 396  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39305262 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgaga 39305177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151365 times since January 2019
Visitors: 1526