View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_13 (Length: 472)

Name: NF0095_high_13
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_13
NF0095_high_13
[»] chr4 (1 HSPs)
chr4 (29-446)||(55245311-55245731)
[»] chr2 (1 HSPs)
chr2 (64-168)||(8269967-8270071)


Alignment Details
Target: chr4 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 29 - 446
Target Start/End: Complemental strand, 55245731 - 55245311
Alignment:
29 aaaacataccctagtaattgtgaggagctggctaattcaagcttgaagaagaggttcctcaagagagctaaagaagagaggtccaggctctacatactaa 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55245731 aaaacataccctagtaattgtgaggagctggctaattcaagcttgaagaagaggttcctcaagagagctaaagaagagaggtccaggctctacatactaa 55245632  T
129 agaggtgcattattatgttactatgttggcacaagtacgaacaatattaattcatttactacacaaaccccactattattttttaaggtaacattaattc 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||    
55245631 agaggtgcattattatgttactatgttggcacaagtacgaacaatattaattcatttactacacaatccacactattattttt-aaggtaacattaattc 55245533  T
229 tagtagctagtttttattattttagtgact----actatataattgtggtattggtgttgtgttatatagtagatatttgttagaaaaaacaacatatga 324  Q
    |||||||||||||||||| |||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55245532 tagtagctagtttttattgttttagtgactgactactatataattgtggtattggtgttgtgttatatagtagatatttgttagaaaaaacaacatatga 55245433  T
325 atacacaaaatttgttaacgtggtttggccaattttgcttaagggcaaagcgcatgcagttccttcgtattgaatgaccaagttgagcactttattgcac 424  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
55245432 atacacaaaatttgttaacgtggtttggccaattttgcttaagggcaaagcgcatgcagttccttcgtattgaatgaccaagttgagcacttcattgcac 55245333  T
425 ctgtgaaccttagcttatctga 446  Q
    |||||||||||||||| |||||    
55245332 ctgtgaaccttagcttgtctga 55245311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 64 - 168
Target Start/End: Complemental strand, 8270071 - 8269967
Alignment:
64 ttcaagcttgaagaagaggttcctcaagagagctaaagaagagaggtccaggctctacatactaaagaggtgcattattatgttactatgttggcacaag 163  Q
    |||||||||||||||||||||||| || |  || || ||| ||||||| |||||||| ||| ||||||||||||||||||| |||||||||||||| |||    
8270071 ttcaagcttgaagaagaggttccttaacaaggcaaaggaacagaggtctaggctctatatattaaagaggtgcattattatattactatgttggcaaaag 8269972  T
164 tacga 168  Q
    |||||    
8269971 tacga 8269967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149042 times since January 2019
Visitors: 1515