View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_16 (Length: 446)

Name: NF0095_high_16
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_16
[»] chr8 (3 HSPs)
chr8 (43-439)||(28379653-28380055)
chr8 (42-368)||(28389364-28389698)
chr8 (42-159)||(28414968-28415085)

Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 43 - 439
Target Start/End: Complemental strand, 28380055 - 28379653
43 aaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttcttac 142  Q
28380055 aaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttcttac 28379956  T
143 tcaacatcttcatcttc------tcttaacctgcaaaagtaaaaatatgaagctgcatttcatcagaaacatagttcaaggctaaaatagaagaaaataa 236  Q
    |||||||||||||||||      ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28379955 tcaacatcttcatcttcatcttctcttaacctacaaaagtaaaaatttgaagctgcatttcatcagaaacatagttcaaggctaaaatagaagaaaataa 28379856  T
237 ttaaaaaatttaatgctattaaactaccataccatatataaatgtaatgataattaaaagaatttcaacaagaaaggaaataagacatggacgaacctta 336  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28379855 ttaaaaaaattaatgctattaaactaccataccatatataaatgtaatgataattaaaagaatttcaacaagaaaggaaataagacatggacgaacctta 28379756  T
337 gaatatactaaatgtattaattttcttcatggnnnnnnnnnnnnnccatagaagatgaaagaataaaagaccaagtgagannnnnnngttttctcctatg 436  Q
    ||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||       |||||||||||||    
28379755 gaatatactaaatgtattaattttcttcatggaaaaaacaaaaaaccatagaagatgaaagaataaaagaccaagtgagatttttttgttttctcctatg 28379656  T
437 ata 439  Q
28379655 ata 28379653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 42 - 368
Target Start/End: Complemental strand, 28389698 - 28389364
42 gaaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttctta 141  Q
    |||||| |||||||| ||||||| |||| |||| | ||||||||| || | || ||||||||| ||||||||| | ||||||||||  ||||||||||||    
28389698 gaacctcaatgatgtcttctcagcacaaacacataacaagaaacagaattgcacaatcattccaaaccaccaatataagataacatgtttgttcttctta 28389599  T
142 ctcaacatcttcatcttc------tcttaacctgcaaaagtaaaaatatgaagctgcatttcatcagaaacatagttcaaggctaaaatagaagaaaata 235  Q
    |||||||  |||||||||      ||||||||| ||||||||||||| |||||||||||||||| ||||||||| ||||||||||||| || ||||| ||    
28389598 ctcaacactttcatcttcatcatttcttaacctacaaaagtaaaaatttgaagctgcatttcataagaaacatatttcaaggctaaaaaagtagaaatta 28389499  T
236 attaaaaaatttaatgctattaaactaccataccatatataaatgtaatgataattaaaagaatttcaacaagaaaggaaat-----aagacatggacga 330  Q
    ||||||||| |||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||| |||||     |||||||||||||    
28389498 attaaaaaaattaatgctattaaactactataccatatataaatatgatgataattaaaagaatttcaacaagaaaagaaatttttaaagacatggacga 28389399  T
331 accttagaatatactaaatgtattaattttcttcatgg 368  Q
    |||||||||||   ||||||||||||||||||||||||    
28389398 accttagaata---taaatgtattaattttcttcatgg 28389364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 42 - 159
Target Start/End: Original strand, 28414968 - 28415085
42 gaaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttctta 141  Q
    |||||||||||||||||||| |||||||||||| ||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||    
28414968 gaaccttaatgatgtattctgagaacaagcacatagcaagaaacagaacttcacaatcattccaaaccaccaaaagaagataacattattgttcttcata 28415067  T
142 ctcaacatcttcatcttc 159  Q
    |||||||  |||||||||    
28415068 ctcaacacgttcatcttc 28415085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126593 times since January 2019
Visitors: 1391