View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_17 (Length: 445)

Name: NF0095_high_17
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_17
[»] chr2 (1 HSPs)
chr2 (8-397)||(19082389-19082771)

Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 397
Target Start/End: Original strand, 19082389 - 19082771
8 aattggcatagttacacttaaagcaagatttttatgtttctagtttttcaagctttatgatttttctctgcaaataagtttgtggcttattttttatgac 107  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19082389 aattggcatagttacacttaaagcaagattttaatgtttctagtttttcaagctttatgatttttctctgcaaataagtttgtggcttattttttatgac 19082488  T
108 ctgtaannnnnnngaataatacgttgaatcacgatgacattacattattaatttaccacataatcaaatataattccacannnnnnnnnatttctttctn 207  Q
     |||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           ||| |||||     
19082489 gtgtaaattttttgaataatacgttgaatcacgatgacattacattattaatttaccacataatcaaatataattccacttt--------tttttttcta 19082580  T
208 nnnnnntaatataactccacatcatcaattaattaatatggcatgtcataaaa-aatcgtttgaaaacgagttgtgtgaaagaaattttaaacttgtaaa 306  Q
          |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||    
19082581 aaaaaataatataattccacatcatcaattaattaatatggcatgtcataaaaaaatcgtttgaaaacgagttgtgcgaaagaaattttaaaattgtaaa 19082680  T
307 acatagactaaaattttagagaaacaaatccatggactaaaatctttttgagattaaaaatttgaaccatgtcaaattcttgttttctgat 397  Q
    |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19082681 acatagactaaaattttagataaacaaatgcatggactaaaatctttttgagattaaaaatttgaaccatgtcaaattcttgttttctgat 19082771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126690 times since January 2019
Visitors: 1391