View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_19 (Length: 441)

Name: NF0095_high_19
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_19
[»] chr7 (1 HSPs)
chr7 (29-431)||(30450276-30450678)

Alignment Details
Target: chr7 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 29 - 431
Target Start/End: Original strand, 30450276 - 30450678
29 aagtcctgtgagggtcaatcaaaatgaggtaattgcattcaactcccttggaaattgaaggtaggttggtgcaattttcccgacaaatgagggtaatgag 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
30450276 aagtcctgtgagggtcaatcaaaatgaggtaattgcattcaactccctttgaaattgaaggtaggttggtgcaattttcccgacaaatgagggtaatgag 30450375  T
129 cttttgtttaaaaaattaaagatgtgtacgtgttatttaagcatacctcaaggggtatgtatgagtgcaacttctccaagcaaaatcaaactttttgttg 228  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
30450376 cttttgtttaaaaaatcaaagatgtgtacgtgttatttaagcatacctcatggggtatgtatgagtgcaacttctccaagcaaaatcaaactttttgttg 30450475  T
229 ttgaaaaggacagcttttgttactactattattgaaggatgtgctttactgcttttactaaaaacttcttacttatcagttctttatgtactgtggttag 328  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30450476 ttgaaaaagacagcttttgttactactattattgaaggatgtgctttactgcttttactaaaaacttcttacttatcagttctttatgtactgtggttag 30450575  T
329 tgggaccaaagcctttagctttttattcatacacttgcattcctatgttgccttttatttacaggatgcccagaaagaatgtcttcttgttaacgcccct 428  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30450576 tgggaccaaagcctttagctttttattcatacacatgcattcctatgttgccttttatttacaggatgcccagaaagaatgtcttcttgttaacgcccct 30450675  T
429 ttg 431  Q
30450676 ttg 30450678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126323 times since January 2019
Visitors: 1390