View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_2 (Length: 577)

Name: NF0095_high_2
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_2
NF0095_high_2
[»] chr6 (38 HSPs)
chr6 (30-328)||(22492050-22492348)
chr6 (329-568)||(19285539-19285778)
chr6 (327-568)||(30270494-30270736)
chr6 (329-568)||(19787418-19787659)
chr6 (329-568)||(12166627-12166869)
chr6 (328-568)||(19882494-19882737)
chr6 (328-568)||(34641523-34641770)
chr6 (329-568)||(19876719-19876961)
chr6 (329-568)||(34648197-34648443)
chr6 (329-568)||(25471240-25471477)
chr6 (399-550)||(21794035-21794187)
chr6 (399-550)||(26419303-26419456)
chr6 (330-421)||(11284541-11284632)
chr6 (399-463)||(8761079-8761144)
chr6 (400-463)||(8768816-8768880)
chr6 (402-463)||(7428797-7428857)
chr6 (399-453)||(22757726-22757779)
chr6 (399-453)||(5295268-5295324)
chr6 (399-458)||(9623379-9623437)
chr6 (399-463)||(14595317-14595381)
chr6 (399-445)||(23236064-23236111)
chr6 (399-453)||(28707406-28707460)
chr6 (399-453)||(1592248-1592305)
chr6 (399-463)||(2707837-2707901)
chr6 (399-453)||(21717574-21717630)
chr6 (399-453)||(21725410-21725466)
chr6 (399-446)||(14616930-14616978)
chr6 (399-458)||(18316689-18316747)
chr6 (399-453)||(24514489-24514543)
chr6 (278-328)||(237421-237471)
chr6 (278-328)||(11785353-11785403)
chr6 (399-444)||(14996625-14996671)
chr6 (278-328)||(28965863-28965913)
chr6 (279-328)||(9954547-9954596)
chr6 (399-444)||(19473006-19473051)
chr6 (399-444)||(22799198-22799243)
chr6 (399-444)||(24412977-24413022)
chr6 (399-444)||(24720044-24720089)
[»] chr1 (41 HSPs)
chr1 (328-568)||(20046425-20046665)
chr1 (329-568)||(20053463-20053702)
chr1 (399-550)||(21541340-21541492)
chr1 (401-550)||(24076779-24076931)
chr1 (399-550)||(47483558-47483710)
chr1 (399-502)||(24109669-24109771)
chr1 (332-437)||(26722973-26723079)
chr1 (399-463)||(19858627-19858691)
chr1 (399-453)||(3707408-3707463)
chr1 (328-419)||(41110199-41110289)
chr1 (397-453)||(11944539-11944595)
chr1 (399-463)||(19852492-19852556)
chr1 (399-463)||(23196231-23196295)
chr1 (399-463)||(29555088-29555152)
chr1 (377-444)||(20942533-20942600)
chr1 (399-453)||(43631470-43631524)
chr1 (399-444)||(20639723-20639769)
chr1 (278-328)||(27352628-27352678)
chr1 (399-463)||(20032645-20032709)
chr1 (399-443)||(20825012-20825057)
chr1 (399-443)||(20838831-20838876)
chr1 (399-458)||(2341670-2341729)
chr1 (280-328)||(9445108-9445156)
chr1 (377-444)||(16884217-16884284)
chr1 (278-316)||(10435833-10435871)
chr1 (278-316)||(29489394-29489432)
chr1 (278-328)||(40612112-40612162)
chr1 (278-328)||(50226902-50226952)
chr1 (399-444)||(11141686-11141731)
chr1 (401-445)||(21663622-21663667)
chr1 (399-444)||(21697587-21697632)
chr1 (399-444)||(23630405-23630450)
chr1 (403-444)||(23711928-23711969)
chr1 (279-328)||(26501294-26501343)
chr1 (279-328)||(31427980-31428029)
chr1 (399-444)||(31928092-31928137)
chr1 (279-328)||(39669805-39669854)
chr1 (279-328)||(43457842-43457891)
chr1 (377-444)||(11156389-11156456)
chr1 (399-463)||(20848489-20848552)
chr1 (278-326)||(52669793-52669841)
[»] scaffold0088 (1 HSPs)
scaffold0088 (329-568)||(25904-26143)
[»] chr7 (45 HSPs)
chr7 (329-568)||(12592179-12592419)
chr7 (331-568)||(16928187-16928427)
chr7 (328-568)||(13005689-13005938)
chr7 (399-550)||(26295364-26295517)
chr7 (328-426)||(12711592-12711688)
chr7 (329-426)||(13124662-13124757)
chr7 (399-502)||(37244995-37245097)
chr7 (399-551)||(16952869-16953022)
chr7 (373-458)||(18959162-18959244)
chr7 (329-426)||(13741895-13741990)
chr7 (421-547)||(46173624-46173751)
chr7 (399-463)||(10306075-10306139)
chr7 (399-551)||(16946269-16946422)
chr7 (399-453)||(36306767-36306821)
chr7 (399-557)||(3902-4064)
chr7 (399-463)||(125250-125314)
chr7 (399-463)||(10305389-10305453)
chr7 (399-453)||(15338301-15338357)
chr7 (399-453)||(15711636-15711692)
chr7 (399-463)||(16185063-16185127)
chr7 (399-458)||(8775239-8775298)
chr7 (399-458)||(21744431-21744490)
chr7 (399-458)||(46349409-46349468)
chr7 (399-445)||(3290447-3290494)
chr7 (399-453)||(11395356-11395410)
chr7 (399-444)||(3327188-3327234)
chr7 (399-444)||(15086730-15086776)
chr7 (399-453)||(15723861-15723918)
chr7 (279-328)||(19426579-19426628)
chr7 (399-463)||(38827153-38827217)
chr7 (399-497)||(6411287-6411386)
chr7 (278-326)||(33223554-33223602)
chr7 (399-444)||(10308666-10308712)
chr7 (278-328)||(42060654-42060704)
chr7 (278-316)||(44511137-44511175)
chr7 (399-444)||(12694049-12694094)
chr7 (399-444)||(13677734-13677779)
chr7 (399-444)||(15098633-15098678)
chr7 (279-328)||(23761058-23761107)
chr7 (399-444)||(46624308-46624353)
chr7 (403-444)||(46682873-46682914)
chr7 (280-328)||(20406541-20406589)
chr7 (484-559)||(23518284-23518359)
chr7 (280-316)||(29763830-29763866)
chr7 (399-458)||(32770805-32770864)
[»] chr8 (46 HSPs)
chr8 (329-568)||(17052991-17053230)
chr8 (399-550)||(23824456-23824608)
chr8 (329-426)||(25408972-25409068)
chr8 (327-426)||(19903622-19903719)
chr8 (399-550)||(29327483-29327635)
chr8 (399-559)||(27889314-27889475)
chr8 (399-559)||(27947972-27948133)
chr8 (329-422)||(23864834-23864925)
chr8 (399-555)||(22176450-22176607)
chr8 (399-453)||(22064245-22064301)
chr8 (399-463)||(22248483-22248547)
chr8 (399-502)||(31419356-31419458)
chr8 (399-453)||(21281452-21281506)
chr8 (399-463)||(7302263-7302327)
chr8 (399-463)||(21322901-21322965)
chr8 (399-463)||(21327489-21327553)
chr8 (399-463)||(36601092-36601156)
chr8 (399-463)||(44494693-44494757)
chr8 (399-502)||(31412917-31413019)
chr8 (278-326)||(39021468-39021516)
chr8 (400-463)||(44430844-44430907)
chr8 (399-458)||(45136052-45136111)
chr8 (399-453)||(6609372-6609426)
chr8 (278-329)||(22852861-22852912)
chr8 (399-453)||(28852895-28852949)
chr8 (278-328)||(11223882-11223932)
chr8 (399-444)||(21300846-21300892)
chr8 (399-453)||(22989030-22989084)
chr8 (278-328)||(40842012-40842062)
chr8 (399-444)||(19988868-19988915)
chr8 (280-324)||(21273737-21273781)
chr8 (280-328)||(28623134-28623182)
chr8 (277-324)||(26294186-26294233)
chr8 (277-324)||(26307443-26307490)
chr8 (402-463)||(11773703-11773764)
chr8 (399-463)||(34949629-34949695)
chr8 (278-328)||(45101394-45101444)
chr8 (399-463)||(5239471-5239535)
chr8 (275-328)||(11879513-11879566)
chr8 (275-328)||(11896929-11896982)
chr8 (399-444)||(19852944-19852989)
chr8 (399-444)||(19858980-19859025)
chr8 (399-444)||(20005804-20005849)
chr8 (407-453)||(22026242-22026290)
chr8 (279-328)||(37873128-37873177)
chr8 (377-444)||(18609569-18609637)
[»] chr2 (33 HSPs)
chr2 (328-568)||(5707559-5707800)
chr2 (401-550)||(21133917-21134067)
chr2 (400-550)||(36799947-36800099)
chr2 (399-550)||(43692777-43692929)
chr2 (399-550)||(25590735-25590886)
chr2 (399-550)||(27368172-27368324)
chr2 (399-555)||(22809354-22809511)
chr2 (329-426)||(26582066-26582161)
chr2 (399-463)||(6031629-6031693)
chr2 (399-463)||(20964652-20964716)
chr2 (399-463)||(24503659-24503723)
chr2 (399-463)||(25036742-25036806)
chr2 (399-463)||(25040849-25040913)
chr2 (399-463)||(31754915-31754979)
chr2 (377-444)||(23061933-23062000)
chr2 (399-453)||(23029694-23029748)
chr2 (393-463)||(25108123-25108193)
chr2 (280-326)||(39247488-39247534)
chr2 (281-324)||(26321724-26321767)
chr2 (281-324)||(26321892-26321935)
chr2 (278-328)||(5954506-5954556)
chr2 (278-328)||(11229344-11229394)
chr2 (399-444)||(21906700-21906746)
chr2 (534-564)||(23169843-23169873)
chr2 (377-443)||(23263414-23263479)
chr2 (377-443)||(23268630-23268695)
chr2 (534-564)||(23581100-23581130)
chr2 (278-328)||(31296868-31296918)
chr2 (278-327)||(4738596-4738645)
chr2 (278-327)||(33296095-33296144)
chr2 (279-328)||(36909866-36909915)
chr2 (280-316)||(3039864-3039900)
chr2 (280-324)||(3091741-3091785)
[»] scaffold0730 (1 HSPs)
scaffold0730 (329-568)||(4306-4551)
[»] scaffold0148 (1 HSPs)
scaffold0148 (329-568)||(93-338)
[»] chr5 (41 HSPs)
chr5 (329-568)||(23526838-23527079)
chr5 (399-550)||(21676123-21676275)
chr5 (397-550)||(42242356-42242510)
chr5 (399-453)||(22509813-22509869)
chr5 (399-463)||(22759852-22759916)
chr5 (399-463)||(22880006-22880070)
chr5 (399-453)||(24669686-24669742)
chr5 (399-453)||(24739455-24739511)
chr5 (399-453)||(24752224-24752280)
chr5 (399-463)||(33474542-33474606)
chr5 (399-458)||(43120151-43120210)
chr5 (399-453)||(19075436-19075490)
chr5 (399-445)||(21661816-21661863)
chr5 (278-328)||(26660434-26660484)
chr5 (278-328)||(26932026-26932076)
chr5 (399-441)||(30344822-30344864)
chr5 (399-453)||(758910-758966)
chr5 (399-444)||(23433520-23433565)
chr5 (399-444)||(23444885-23444930)
chr5 (279-328)||(36713201-36713250)
chr5 (399-463)||(43244394-43244458)
chr5 (276-328)||(14914368-14914420)
chr5 (399-458)||(43123684-43123743)
chr5 (399-453)||(31253688-31253742)
chr5 (279-325)||(3771032-3771078)
chr5 (402-463)||(6728904-6728965)
chr5 (278-328)||(11768013-11768063)
chr5 (280-326)||(19127124-19127170)
chr5 (278-328)||(23991157-23991207)
chr5 (278-328)||(38500941-38500991)
chr5 (279-328)||(14323991-14324040)
chr5 (399-548)||(22378920-22379072)
chr5 (399-444)||(25013080-25013125)
chr5 (279-316)||(35814452-35814489)
chr5 (280-328)||(12718403-12718451)
chr5 (280-328)||(12779629-12779677)
chr5 (400-444)||(21905970-21906014)
chr5 (484-559)||(28260482-28260556)
chr5 (280-328)||(34381012-34381060)
chr5 (280-328)||(39595272-39595320)
chr5 (280-328)||(42699057-42699105)
[»] scaffold0693 (1 HSPs)
scaffold0693 (329-568)||(1423-1664)
[»] scaffold0125 (1 HSPs)
scaffold0125 (329-568)||(24744-24985)
[»] chr4 (55 HSPs)
chr4 (399-550)||(33096429-33096581)
chr4 (329-470)||(53482649-53482791)
chr4 (399-550)||(37880791-37880942)
chr4 (399-550)||(898994-899147)
chr4 (329-426)||(8056313-8056408)
chr4 (392-463)||(41939995-41940066)
chr4 (399-555)||(14479926-14480083)
chr4 (399-549)||(31664390-31664541)
chr4 (399-453)||(10687514-10687568)
chr4 (399-453)||(10901154-10901208)
chr4 (402-463)||(14062382-14062444)
chr4 (421-550)||(46045470-46045599)
chr4 (399-463)||(55503806-55503870)
chr4 (280-328)||(1031755-1031803)
chr4 (399-458)||(4169941-4170000)
chr4 (362-426)||(11846478-11846542)
chr4 (399-458)||(31132422-31132481)
chr4 (399-550)||(33198347-33198499)
chr4 (399-445)||(2585834-2585881)
chr4 (399-453)||(12931302-12931357)
chr4 (399-444)||(14697664-14697710)
chr4 (399-444)||(38982701-38982747)
chr4 (401-458)||(41529731-41529788)
chr4 (520-569)||(11846638-11846687)
chr4 (400-444)||(14484972-14485016)
chr4 (402-453)||(37839669-37839720)
chr4 (377-464)||(40908037-40908123)
chr4 (281-329)||(45548806-45548854)
chr4 (369-458)||(13451507-13451594)
chr4 (401-463)||(16220700-16220762)
chr4 (399-453)||(42598398-42598452)
chr4 (278-328)||(4896523-4896573)
chr4 (538-568)||(8056168-8056198)
chr4 (280-326)||(15596396-15596442)
chr4 (278-328)||(23094374-23094424)
chr4 (399-453)||(27904692-27904749)
chr4 (400-464)||(30395536-30395604)
chr4 (278-328)||(36444418-36444468)
chr4 (278-328)||(44170642-44170692)
chr4 (279-329)||(47998593-47998643)
chr4 (278-324)||(51318701-51318747)
chr4 (278-328)||(51717305-51717355)
chr4 (430-502)||(11171855-11171928)
chr4 (399-444)||(14992307-14992352)
chr4 (399-444)||(15005654-15005699)
chr4 (399-444)||(16484055-16484100)
chr4 (399-444)||(18260741-18260786)
chr4 (399-444)||(18270704-18270749)
chr4 (399-444)||(30237195-30237240)
chr4 (399-444)||(30873262-30873307)
chr4 (280-324)||(169529-169573)
chr4 (390-437)||(1651733-1651781)
chr4 (280-324)||(30042134-30042178)
chr4 (280-328)||(31240648-31240696)
chr4 (280-328)||(39010160-39010208)
[»] chr3 (48 HSPs)
chr3 (399-550)||(24123899-24124051)
chr3 (399-559)||(29550307-29550467)
chr3 (397-550)||(49162600-49162754)
chr3 (399-550)||(18957210-18957364)
chr3 (329-437)||(41456827-41456936)
chr3 (399-550)||(12418782-12418935)
chr3 (329-423)||(16490791-16490886)
chr3 (373-455)||(18757694-18757773)
chr3 (399-555)||(14292167-14292330)
chr3 (399-555)||(14542235-14542398)
chr3 (278-324)||(55344323-55344369)
chr3 (399-463)||(40538-40602)
chr3 (399-463)||(2249686-2249750)
chr3 (399-463)||(2270910-2270974)
chr3 (366-453)||(18719760-18719845)
chr3 (399-453)||(20187092-20187148)
chr3 (399-463)||(54900761-54900825)
chr3 (377-444)||(15518484-15518551)
chr3 (399-550)||(20377867-20378018)
chr3 (399-453)||(5840713-5840767)
chr3 (376-446)||(13325521-13325591)
chr3 (399-453)||(45221440-45221494)
chr3 (278-328)||(47849670-47849720)
chr3 (376-444)||(13303932-13304000)
chr3 (376-444)||(13314608-13314676)
chr3 (399-463)||(14648919-14648983)
chr3 (280-328)||(20380912-20380960)
chr3 (399-445)||(17495584-17495631)
chr3 (278-329)||(48945845-48945896)
chr3 (399-441)||(11851402-11851444)
chr3 (402-464)||(11957306-11957371)
chr3 (399-445)||(12356672-12356718)
chr3 (399-441)||(16830678-16830720)
chr3 (279-329)||(30796636-30796686)
chr3 (399-444)||(54972260-54972306)
chr3 (399-444)||(54974870-54974916)
chr3 (399-444)||(54977480-54977526)
chr3 (280-329)||(1295332-1295381)
chr3 (399-444)||(8374730-8374775)
chr3 (399-444)||(13037612-13037657)
chr3 (399-444)||(13043977-13044022)
chr3 (399-444)||(15935688-15935733)
chr3 (399-444)||(15937538-15937583)
chr3 (532-569)||(16802992-16803029)
chr3 (280-328)||(462424-462472)
chr3 (280-328)||(9027873-9027921)
chr3 (280-328)||(20893265-20893313)
chr3 (280-328)||(51464295-51464343)
[»] scaffold0104 (2 HSPs)
scaffold0104 (402-550)||(22698-22847)
scaffold0104 (402-550)||(19878-20027)
[»] scaffold0029 (2 HSPs)
scaffold0029 (328-426)||(116218-116314)
scaffold0029 (329-426)||(110150-110245)
[»] scaffold0006 (1 HSPs)
scaffold0006 (329-427)||(48441-48538)
[»] scaffold0060 (1 HSPs)
scaffold0060 (400-550)||(40682-40833)
[»] scaffold0622 (1 HSPs)
scaffold0622 (328-426)||(268-364)
[»] scaffold0058 (5 HSPs)
scaffold0058 (328-426)||(16684-16780)
scaffold0058 (399-463)||(33883-33947)
scaffold0058 (399-453)||(15952-16006)
scaffold0058 (400-453)||(23457-23510)
scaffold0058 (400-444)||(41158-41202)
[»] scaffold0117 (1 HSPs)
scaffold0117 (329-426)||(10325-10420)
[»] scaffold0811 (1 HSPs)
scaffold0811 (329-426)||(646-741)
[»] scaffold0074 (1 HSPs)
scaffold0074 (401-497)||(16409-16506)
[»] scaffold0026 (2 HSPs)
scaffold0026 (399-463)||(125119-125184)
scaffold0026 (399-444)||(28609-28654)
[»] scaffold0188 (1 HSPs)
scaffold0188 (399-502)||(32237-32340)
[»] scaffold0634 (2 HSPs)
scaffold0634 (328-458)||(1958-2087)
scaffold0634 (520-571)||(2151-2202)
[»] scaffold0037 (1 HSPs)
scaffold0037 (401-559)||(102271-102431)
[»] scaffold0461 (2 HSPs)
scaffold0461 (377-444)||(1760-1827)
scaffold0461 (377-444)||(8696-8763)
[»] scaffold0023 (1 HSPs)
scaffold0023 (400-453)||(21107-21162)
[»] scaffold0031 (1 HSPs)
scaffold0031 (399-547)||(74754-74903)
[»] scaffold1340 (1 HSPs)
scaffold1340 (399-463)||(1859-1923)
[»] scaffold0512 (1 HSPs)
scaffold0512 (399-463)||(12036-12100)
[»] scaffold0326 (4 HSPs)
scaffold0326 (399-453)||(1087-1143)
scaffold0326 (389-452)||(16908-16973)
scaffold0326 (399-445)||(7985-8031)
scaffold0326 (399-445)||(15887-15933)
[»] scaffold0301 (1 HSPs)
scaffold0301 (399-455)||(14068-14125)
[»] scaffold0072 (1 HSPs)
scaffold0072 (399-463)||(55381-55445)
[»] scaffold0011 (4 HSPs)
scaffold0011 (399-463)||(251345-251409)
scaffold0011 (377-444)||(198116-198183)
scaffold0011 (399-463)||(257964-258028)
scaffold0011 (278-328)||(219687-219737)
[»] scaffold0003 (2 HSPs)
scaffold0003 (399-453)||(194567-194623)
scaffold0003 (400-463)||(136843-136906)
[»] scaffold0610 (1 HSPs)
scaffold0610 (377-444)||(4955-5022)
[»] scaffold0298 (1 HSPs)
scaffold0298 (377-444)||(1329-1396)
[»] scaffold0141 (1 HSPs)
scaffold0141 (399-458)||(32105-32164)
[»] scaffold0049 (1 HSPs)
scaffold0049 (399-458)||(82648-82707)
[»] scaffold0001 (3 HSPs)
scaffold0001 (362-418)||(488546-488602)
scaffold0001 (399-455)||(95310-95366)
scaffold0001 (399-444)||(452421-452466)
[»] scaffold1542 (1 HSPs)
scaffold1542 (397-444)||(1487-1534)
[»] scaffold0751 (1 HSPs)
scaffold0751 (397-444)||(6505-6552)
[»] scaffold0679 (1 HSPs)
scaffold0679 (399-453)||(3771-3825)
[»] scaffold0323 (1 HSPs)
scaffold0323 (405-555)||(6728-6882)
[»] scaffold1615 (1 HSPs)
scaffold1615 (399-444)||(1083-1129)
[»] scaffold0190 (1 HSPs)
scaffold0190 (399-550)||(27948-28101)
[»] scaffold0098 (1 HSPs)
scaffold0098 (402-463)||(33602-33663)
[»] scaffold0077 (2 HSPs)
scaffold0077 (399-444)||(18841-18887)
scaffold0077 (399-444)||(24468-24514)
[»] scaffold0516 (1 HSPs)
scaffold0516 (399-463)||(8271-8335)
[»] scaffold0154 (1 HSPs)
scaffold0154 (279-328)||(4314-4363)
[»] scaffold0120 (1 HSPs)
scaffold0120 (401-445)||(5831-5876)
[»] scaffold0342 (1 HSPs)
scaffold0342 (399-463)||(17526-17593)
[»] scaffold0139 (1 HSPs)
scaffold0139 (377-444)||(16726-16793)
[»] scaffold0090 (1 HSPs)
scaffold0090 (362-426)||(17398-17462)
[»] scaffold0511 (1 HSPs)
scaffold0511 (399-458)||(673-731)
[»] scaffold1061 (1 HSPs)
scaffold1061 (377-443)||(717-782)
[»] scaffold0235 (2 HSPs)
scaffold0235 (399-444)||(7391-7437)
scaffold0235 (399-444)||(17605-17651)
[»] scaffold0204 (1 HSPs)
scaffold0204 (278-328)||(27337-27387)
[»] scaffold0076 (1 HSPs)
scaffold0076 (399-453)||(52361-52413)
[»] scaffold0015 (1 HSPs)
scaffold0015 (399-463)||(172460-172520)
[»] scaffold0661 (1 HSPs)
scaffold0661 (399-444)||(4775-4820)
[»] scaffold0574 (1 HSPs)
scaffold0574 (403-463)||(6550-6610)
[»] scaffold0395 (1 HSPs)
scaffold0395 (399-444)||(4778-4823)
[»] scaffold0244 (1 HSPs)
scaffold0244 (399-444)||(20090-20135)
[»] scaffold0220 (1 HSPs)
scaffold0220 (403-453)||(9824-9876)
[»] scaffold0211 (1 HSPs)
scaffold0211 (399-444)||(8782-8827)
[»] scaffold0167 (1 HSPs)
scaffold0167 (397-445)||(6386-6435)
[»] scaffold0109 (1 HSPs)
scaffold0109 (399-463)||(1333-1397)
[»] scaffold0081 (1 HSPs)
scaffold0081 (399-444)||(56610-56655)
[»] scaffold0078 (1 HSPs)
scaffold0078 (399-444)||(18108-18153)
[»] scaffold0054 (1 HSPs)
scaffold0054 (399-444)||(62467-62512)
[»] scaffold0053 (1 HSPs)
scaffold0053 (399-444)||(61698-61743)
[»] scaffold0024 (1 HSPs)
scaffold0024 (276-329)||(60465-60518)
[»] scaffold0007 (1 HSPs)
scaffold0007 (399-444)||(208243-208288)
[»] scaffold0990 (1 HSPs)
scaffold0990 (400-444)||(3329-3373)
[»] scaffold0592 (1 HSPs)
scaffold0592 (278-326)||(8332-8380)
[»] scaffold0355 (1 HSPs)
scaffold0355 (403-444)||(2198-2241)
[»] scaffold0249 (1 HSPs)
scaffold0249 (377-444)||(8400-8467)
[»] scaffold0113 (2 HSPs)
scaffold0113 (424-464)||(14577-14617)
scaffold0113 (424-464)||(18587-18627)
[»] scaffold0004 (2 HSPs)
scaffold0004 (399-443)||(115187-115231)
scaffold0004 (399-458)||(320532-320591)


Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 38)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 30 - 328
Target Start/End: Complemental strand, 22492348 - 22492050
Alignment:
30 gatattaagatgtttgtaaggatcaatggtttgagatggtggtgaagtttgatggctttgatctgacatggttaagcttaattgggactgtgtttagagt 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22492348 gatattaagatgtttgtaaggatcaatggtttgagatggtggtgaagtttgatggctttgatctgacatggttaagcttaattgggactgtgtttagagt 22492249  T
130 caaagcgaatatatgttgcttcagatttctttgagtgattattacaccttgagaggggaatagtgagagtgagactaatgttataggaagacataaatag 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||    
22492248 caaagcgaatatatgttgcttcagatttctttgagtgattattacaccttgagaggggaatagtgagagtgagattaatgttatagaaagacataaatag 22492149  T
230 agataaataaagattctaataaatattagaaagtaagaccaaatcatcaagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
22492148 agataaataaagattctaataaatattagaaagtaagaccaaatcatcaagagaaatgatatatgtacaaccattttgtgataacttcttgacaacttt 22492050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 165; E-Value: 6e-88
Query Start/End: Original strand, 329 - 568
Target Start/End: Original strand, 19285539 - 19285778
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||    
19285539 tgtaacaccccattcccaaatataatttatttaa-taaaataaacacacatcagagtaataaatccaaatgggcatgtcacactgcattttcaaatttct 19285637  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
    |||||||||||||||||||||||||||||| |||||| |||| | || |||||||||||||||||||||||  | ||||||||||||||| |||||| ||    
19285638 gaaatagaatataaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatattcgaaacgtcaacaactgtttaaacct 19285737  T
529 ccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    ||||||||||||||||||| |||||||||||||||||||||    
19285738 ccaaataatatcttggcataaaaagcctcaaccagaataat 19285778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 327 - 568
Target Start/End: Original strand, 30270494 - 30270736
Alignment:
327 tttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatt 425  Q
    |||||||||||||||| ||| |||||||||||||||||||| ||| || |||||||||| ||||| ||||||||||||||||||||| ||||||||||||    
30270494 tttgtaacaccccattcccatatatactttatttaaataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaatt 30270592  T
426 tctgaaatagaatataaaaatctatttattaaatatccaacg-aaaccgtcgtttaatatgcagcggaatattatcattg-aaacgtcaacaactattta 523  Q
    ||||||||||||||||||||||||||||| |||||||||| | ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
30270593 tctgaaatagaatataaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcattgaaaacgtcaacaactattta 30270692  T
524 aaactccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    |||||||||| |||||||||||||||||||| |||||| ||||||    
30270693 aaactccaaacaatatcttggcataaaagcc-caaccaaaataat 30270736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 19787659 - 19787418
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| |||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||    
19787659 tgtaacaccccattcccaaatataatttatttaaataaaataaacacacgtcagagtaataaatccaaatgggcatgtcacactacattttcaaatttct 19787560  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
     ||||||||||||||||||||||||||||| |||||| |||| | || ||||||||||||| |||||||||||  ||||||||||||||| |||||| ||    
19787559 aaaatagaatataaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcagaatattatcaacgaaacgtcaacaactgtttaaacct 19787460  T
529 cc-aaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    || ||||||||||| ||||| |||||||||||||||||||||    
19787459 ccaaaataatatctcggcataaaaagcctcaaccagaataat 19787418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 329 - 568
Target Start/End: Original strand, 12166627 - 12166869
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| ||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
12166627 tgtaacaccccattcccaaatataatttatttaaatgaaataaacacacatcagagtaataaatccaaatgggcatgtcacactacattttcaaatttct 12166726  T
429 gaaatagaatat-aaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaac 527  Q
    |||||||||||| |||||||||||||||||| |||||| |||| | || |||||||||||||||||||||||||  ||||||||||||||| |||||| |    
12166727 gaaatagaatataaaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatcaacgaaacgtcaacaactgtttaaacc 12166826  T
528 tcc-aaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    ||| |||||||||||  |||| |||||||||||||||||||||    
12166827 tccaaaataatatctcagcataaaaagcctcaaccagaataat 12166869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 328 - 568
Target Start/End: Original strand, 19882494 - 19882737
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaattt 426  Q
    ||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||| ||| ||||||||||    
19882494 ttgtaacaccccattcccaaatataatttatttaaataaaataaacacacatcagagtaataaaatccaaatgggcatgtcacaccacactttcaaattt 19882593  T
427 ctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaa 526  Q
    |||||||| ||||||||||||||||||||||| |||||| |||| | || |||||||||||||||||||||||||  ||||||||||||||| ||||||     
19882594 ctgaaataaaatataaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatcaacgaaacgtcaacaactgtttaaac 19882693  T
527 ctcc-aaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    |||| ||||||||||| ||||| |||||||||||||||||||||    
19882694 ctccaaaataatatctcggcataaaaagcctcaaccagaataat 19882737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 328 - 568
Target Start/End: Complemental strand, 34641770 - 34641523
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacatttt-caaatt 425  Q
    ||||||||||||||| |||||||||||||||||||||||| ||| || |||||||||| ||||| ||||||||||||||||||||| |||||| ||||||    
34641770 ttgtaacaccccattcccaaatatactttatttaaataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcatttttcaaatt 34641672  T
426 tctgaaatagaatata----aaaatctatttattaaatatccaacgaaac-cgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactat 520  Q
    ||||||||||||||||    ||||||||||||| |||||||||| ||||  ||||||||||||||||||||||||||||||| |||||||||||||||||    
34641671 tctgaaatagaatatatataaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcatagaaacgtcaacaactat 34641572  T
521 ttaaaactccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    ||||||||||||| ||||||||||||| |||||||||||||||||||||    
34641571 ttaaaactccaaacaatatcttggcataaaaagcctcaaccagaataat 34641523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 329 - 568
Target Start/End: Original strand, 19876719 - 19876961
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatttc 427  Q
    |||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||    
19876719 tgtaacaccccattcccaaatataatttatttaaataaaataaacacacatcagagtaataaaatccaaatgggcatgtcacactacactttcaaatttc 19876818  T
428 tgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaac 527  Q
    ||||||||||||||||||||||||||||||| |||||| |||| | || |||||||||||||||||||||||||  ||||||||||||||| |||||| |    
19876819 tgaaatagaatataaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatcaacgaaacgtcaacaactgtttaaacc 19876918  T
528 tcc-aaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    ||| ||||||||||| | ||| |||||||||||| ||||||||    
19876919 tccaaaataatatctcgacataaaaagcctcaacgagaataat 19876961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 34648443 - 34648197
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacatttt-caaattt 426  Q
    |||||||||||||| || ||||||||||||||||||||| ||| || |||||||||| ||||| ||||||||||||||||||||| |||||| |||||||    
34648443 tgtaacaccccattcccgaatatactttatttaaataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcatttttcaaattt 34648345  T
427 ctgaaatagaatata----aaaatctatttattaaatatccaacgaaac-cgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatt 521  Q
    |||||||||||||||    ||||||||||||| |||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||||||||||||||    
34648344 ctgaaatagaatatatataaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcatagaaacgtcaacaactatt 34648245  T
522 taaaactccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    |||||||||||| ||||||||||||| |||||||||||||||||||||    
34648244 taaaactccaaacaatatcttggcataaaaagcctcaaccagaataat 34648197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 25471477 - 25471240
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| ||||||||| ||||||||  |||||||||||||||||| | | ||||||  |||||||| |||||||||||||||    
25471477 tgtaacaccccattcccaaatataatttatttaa-taaaataaatacacatcagagtaataaaacta-atgggcgagtcacacttcattttcaaatttct 25471380  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
    |||||||||||||||| ||||||||||||| |||||| |||| | || |||||||||||||||||||||||||||||||||||||||||| |||||| ||    
25471379 gaaatagaatataaaa-tctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatcattgaaacgtcaacaactgtttaaatct 25471281  T
529 ccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    ||||||||||||||||||| |||||||||||| ||||||||    
25471280 ccaaataatatcttggcataaaaagcctcaactagaataat 25471240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 21794187 - 21794035
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |||| | || ||||||  ||||||||||||||    
21794187 gggcatgtcacactacattttcaaatttctaaaatagaatataaaaatctatttattaaacatccaatgaaatcatcatttaattagcagcggaatatta 21794088  T
499 tcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
21794087 tcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 21794035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 26419456 - 26419303
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||| |||| ||| ||||| ||||||||||||||||||||||||||||| |||||  |||| | || |||| |   ||||||||||||    
26419456 gggcatgtcacactacttttttaaaatttctaaaatagaatataaaaatctatttattaaacatccattgaaatcatcatttatttaacagcggaatatt 26419357  T
498 atcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    |||||  ||||  |||||||| |||||| |||| |||||| |||||||||||||    
26419356 atcatcaaaacaacaacaactttttaaacctccaaaataaaatcttggcataaa 26419303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 330 - 421
Target Start/End: Complemental strand, 11284632 - 11284541
Alignment:
330 gtaacaccccatttccaaatatac-tttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttca 421  Q
    ||||||||||||| |||||||||  ||||||||| |||||||| |||||||||||||||||| |||| |||||||||||||||| ||||||||    
11284632 gtaacaccccattcccaaatataaatttatttaa-taaaataaacacacatcagagtaataattccaaatgggcatgtcacacttcattttca 11284541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 8761144 - 8761079
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||    
8761144 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaaatctatttaataaacatcc 8761079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 400 - 463
Target Start/End: Complemental strand, 8768880 - 8768816
Alignment:
400 ggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||    
8768880 ggcatgtcacactacattttcaaaatttcttaaatagaatataaaaatctatttaataaacatcc 8768816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 402 - 463
Target Start/End: Original strand, 7428797 - 7428857
Alignment:
402 catgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||| ||||    
7428797 catgtcacactacattttcaaatttctaaaatagaatat-aaaatctatttaataaaaatcc 7428857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 22757726 - 22757779
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||    
22757726 gggcatgtcacactacaatttcaaatttcttaaatagaatat-aaaatctattta 22757779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 5295324 - 5295268
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaa--tataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||||||  ||||||||||||||||    
5295324 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaaatctattta 5295268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 9623437 - 9623379
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||  ||||||||||||    
9623437 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaa--ctatttattaaa 9623379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 14595381 - 14595317
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
14595381 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaaaatcc 14595317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 445
Target Start/End: Complemental strand, 23236111 - 23236064
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaa 445  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||||||    
23236111 gggcatgtcacactacattttcaaattttcttaaatagaatataaaaa 23236064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 28707406 - 28707460
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
28707406 gggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctattta 28707460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 1592248 - 1592305
Alignment:
399 gggcatgtcacactaca-ttttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| ||||||||||||| |||||||  |||||||||||||||||    
1592248 gggcatgtcacactacaattttcaaatttcttaaatagaacatataaaaatctattta 1592305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 2707837 - 2707901
Alignment:
399 gggcatgtcacactaca-ttttcaaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||| |||| |||||||| ||||||||||| |||||||||||| |||| ||||    
2707837 gggcatgtcacactacatttttaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 2707901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 21717630 - 21717574
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| |||||| ||||| |||||||  |||||||||||||||||    
21717630 gggcatgtcacactacaatttcaattttcttaaatagaacatataaaaatctattta 21717574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 21725466 - 21725410
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| |||||| ||||| |||||||  |||||||||||||||||    
21725466 gggcatgtcacactacaatttcaattttcttaaatagaacatataaaaatctattta 21725410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 399 - 446
Target Start/End: Complemental strand, 14616978 - 14616930
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaat 446  Q
    |||||||||||||||||| |||||| ||||| |||||||||||||||||    
14616978 gggcatgtcacactacatattcaaaatttcttaaatagaatataaaaat 14616930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 18316747 - 18316689
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||| ||||||| ||||    
18316747 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaaa-ctatttaataaa 18316689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 24514543 - 24514489
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||||||| |||||||  ||||||||||| ||||||||||||    
24514543 gggcatgtcacactacattttcaaaatttcataaatagaatat-aaaatctattta 24514489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 237471 - 237421
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  |||||||||| ||||||| |||| |||||||||||    
237471 aagagaaatgatatttgtacaaccatcttgtgattactttttgacaacttt 237421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 11785353 - 11785403
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||||| || || |||||||||||    
11785353 aagagaaatgatatttgtacaaccattttgtgacaattttttgacaacttt 11785403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 14996671 - 14996625
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| ||||| || |||||||||||||||    
14996671 gggcatgtcacactacattttcaaaattccttaaatagaatataaaa 14996625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 28965913 - 28965863
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||| | ||||| |||||||||||    
28965913 aagagaaatgatatttgtacaaccattttgttacaactttttgacaacttt 28965863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Original strand, 9954547 - 9954596
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
9954547 agagaaatgatatttgtacaaccaatttgtgacaactttttgacaacttt 9954596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 19473051 - 19473006
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
19473051 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 19473006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 22799243 - 22799198
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
22799243 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 22799198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 24413022 - 24412977
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
24413022 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 24412977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 24720044 - 24720089
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||| |||||||| ||||||| |||||||    
24720044 gggcatgtcacactactttttaaaatttcttaaatagattataaaa 24720089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 41)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 328 - 568
Target Start/End: Complemental strand, 20046665 - 20046425
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttc 427  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20046665 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttc 20046566  T
428 tgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaac 527  Q
    |||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||    
20046565 tgaaatagaatataaaaatctatttattaaatatccgacgaaatcgtcgtttattatgaagcggaatattatcattgaaacgtcaacaactatttaaaac 20046466  T
528 tccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    |||||||||||||||||||||||||||||||||||||||||    
20046465 tccaaataatatcttggcataaaagcctcaaccagaataat 20046425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 20053702 - 20053463
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20053702 tgtaacaccctattcccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 20053603  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
    ||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
20053602 gaaatagaatataaaaatctatttattaaatatccgacgaaatcgtcgtttattatgaagcggaatattatcattgaaacgtcaacaactatttaaaact 20053503  T
529 ccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    ||||||||||||||||||||||||||||||||||||||||    
20053502 ccaaataatatcttggcataaaagcctcaaccagaataat 20053463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 21541340 - 21541492
Alignment:
399 gggcatgtcacactacattttcaaattt--ctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||||||||||||||  || |||||||||||||||  ||||||| |||| |||||| |||| | || ||||||  ||||||||||||    
21541340 gggcatgtcacactacattttcaaatttttcttaaatagaatataaaa--ctatttaataaacatccaatgaaatcatcatttaattagcagcggaatat 21541437  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
21541438 tatcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 21541492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 401 - 550
Target Start/End: Original strand, 24076779 - 24076931
Alignment:
401 gcatgtcacactacattttcaaa-tttctgaaatagaatataaaa-atctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    ||||||||||||||  ||||||| ||||| ||||||||||||||| |||||||||||||| |||||  |||| | || ||||||  ||| ||||||||||    
24076779 gcatgtcacactactatttcaaaatttctaaaatagaatataaaaaatctatttattaaacatccagtgaaatcatcatttaattagcaacggaatatta 24076878  T
499 tcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    |||| ||||| ||||||||| |||||| |||| ||||||||||||||||||||    
24076879 tcatcgaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 24076931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 47483558 - 47483710
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||  | ||||| ||||| ||||||||||||||||||||||||||||| |||||  |||| |  | ||||||  |||||||||||||    
47483558 gggcatgtcacactactatatcaaaatttcttaaatagaatataaaaatctatttattaaacatccatagaaatcaacatttaatcagcagcggaatatt 47483657  T
498 atcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||   |||| ||||||| | |||||| |||| ||||||||||||||||||||    
47483658 atca-gcaaacatcaacaagtgtttaaacctccaaaataatatcttggcataaa 47483710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 399 - 502
Target Start/End: Complemental strand, 24109771 - 24109669
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    ||||||||||||||||||||||||| |||  |||||||||||||||| |||||||||||  ||||| ||||| | || |||| |  |||||||||||||     
24109771 gggcatgtcacactacattttcaaaattcctaaatagaatataaaaa-ctatttattaagcatccatcgaaatcatcatttatttagcagcggaatattc 24109673  T
499 tcat 502  Q
    ||||    
24109672 tcat 24109669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 332 - 437
Target Start/End: Complemental strand, 26723079 - 26722973
Alignment:
332 aacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaa-taaatccaca-tgggcatgtcacactacattttcaaatttctg 429  Q
    ||||||||||| ||||||||| ||||||||| |||||||| ||||||||||||||| ||||| || | ||||||||||||| | ||||||||||  |||     
26723079 aacaccccattcccaaatataatttatttaa-taaaataaacacacatcagagtaattaaattcaaattgggcatgtcacatttcattttcaaaactctt 26722981  T
430 aaatagaa 437  Q
    ||||||||    
26722980 aaatagaa 26722973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 19858627 - 19858691
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||| ||||    
19858627 gggcatgtcacactacattttcaaaatttctgaaatagaatataaaaa-ctatttaataaacatcc 19858691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 3707463 - 3707408
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatata-aaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||    
3707463 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaatctattta 3707408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 419
Target Start/End: Original strand, 41110199 - 41110289
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacatttt 419  Q
    ||||||||||||||| | |||||||  |||||||| |||||||| |||||||||||||||||  | || ||||||||||| |||| ||||||    
41110199 ttgtaacaccccattcctaaatataaattatttaa-taaaataaacacacatcagagtaatattttcaaatgggcatgtcgcacttcatttt 41110289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 397 - 453
Target Start/End: Original strand, 11944539 - 11944595
Alignment:
397 atgggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
11944539 atgggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctattta 11944595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 19852492 - 19852556
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||| ||||||| |||| ||||    
19852492 gggcatgtcacactacattttcaaaatttctaaaatagaatataaaaa-ctatttaataaacatcc 19852556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 23196295 - 23196231
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||| ||||||| |||| ||||    
23196295 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaaa-ctatttaataaacatcc 23196231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 29555152 - 29555088
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
29555152 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 29555088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 444
Target Start/End: Complemental strand, 20942600 - 20942533
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    ||||||||||||||  ||| | |||||||||||||||||||||| |||||||| |||||||||||||||    
20942600 catcagagtaataac-ccaaacgggcatgtcacactacattttcaaaatttcttaaatagaatataaaa 20942533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 43631524 - 43631470
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
43631524 gggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctattta 43631470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 20639723 - 20639769
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaa 444  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||    
20639723 gggcatgtcacactacattttcaaattttcttaaatagaatataaaa 20639769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 27352628 - 27352678
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||||||||||| | |||||||||    
27352628 aagagaaatgatatttgtacaaccattttgtgataacttttggacaacttt 27352678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 20032709 - 20032645
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||| |||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
20032709 gggcatgtcacactatattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 20032645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 443
Target Start/End: Complemental strand, 20825057 - 20825012
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaa 443  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||    
20825057 gggcatgtcacactacattttcaaaatttcttaaatagaatataaa 20825012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 443
Target Start/End: Complemental strand, 20838876 - 20838831
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaa 443  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||    
20838876 gggcatgtcacactacattttcaaaatttcttaaatagaatataaa 20838831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 2341729 - 2341670
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| ||| |||| ||||||||||| |||||||||||| ||||    
2341729 gggcatgtcacactacattttcaaaaattcttaaatagaatat-aaaatctatttaataaa 2341670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 9445108 - 9445156
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||| |||||||||||||||| | ||||| |||||||||||    
9445108 gagaaatgatattcgtacaaccattttgtaacaactttttgacaacttt 9445156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 377 - 444
Target Start/End: Complemental strand, 16884284 - 16884217
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    ||||||||||||||  ||| | ||||||||||||||| |||||| |||||||| |||||||||||||||    
16884284 catcagagtaataac-ccaaacgggcatgtcacactatattttcaaaatttcttaaatagaatataaaa 16884217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 316
Target Start/End: Complemental strand, 10435871 - 10435833
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataactt 316  Q
    |||||||||||||| |||||||||||||||||| |||||    
10435871 aagagaaatgatattcgtacaaccattttgtgacaactt 10435833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 316
Target Start/End: Complemental strand, 29489432 - 29489394
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataactt 316  Q
    ||||||||||||||  |||||||||||||||||||||||    
29489432 aagagaaatgatatttgtacaaccattttgtgataactt 29489394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 40612112 - 40612162
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||||| |||||||  ||||||||    
40612112 aagagaaatgatatttgtacaaccattttgtgacaacttctccacaacttt 40612162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 50226952 - 50226902
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
50226952 aagagaaatgatatttgtacaaccactttgtgacaactttttgacaacttt 50226902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 11141731 - 11141686
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
11141731 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 11141686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 401 - 445
Target Start/End: Original strand, 21663622 - 21663667
Alignment:
401 gcatgtcacactacattttc-aaatttctgaaatagaatataaaaa 445  Q
    |||||||||||||||||||| |||||||| ||||||||| ||||||    
21663622 gcatgtcacactacattttcaaaatttcttaaatagaatgtaaaaa 21663667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 21697587 - 21697632
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
21697587 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 21697632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 23630405 - 23630450
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
23630405 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 23630450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 403 - 444
Target Start/End: Original strand, 23711928 - 23711969
Alignment:
403 atgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||| |||| |||||||| |||||||||||||||    
23711928 atgtcacactactttttaaaatttcttaaatagaatataaaa 23711969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Original strand, 26501294 - 26501343
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||||||||| ||||||| | |||||||||    
26501294 agagaaatgatatttgtacaaccattttgtaataacttttggacaacttt 26501343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 31428029 - 31427980
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||| ||||||| || ||||||||||||||    
31428029 agagaaatgatatttgtacaaccactttgtgacaatttcttgacaacttt 31427980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 31928137 - 31928092
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
31928137 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 31928092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Original strand, 39669805 - 39669854
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||||||||||| || || |||||||||||    
39669805 agagaaatgatatttgtacaaccattttgtgacaattttttgacaacttt 39669854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 43457891 - 43457842
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  |||||||||||||| |||||||| | |||||||||    
43457891 agagaaatgatatttgtacaaccattttgcgataacttttggacaacttt 43457842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 377 - 444
Target Start/End: Original strand, 11156389 - 11156456
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    ||||||||||||||  ||| | |||||||||||||||||||||| |||||| | ||||||||| |||||    
11156389 catcagagtaataac-ccaaacgggcatgtcacactacattttcaaaatttattaaatagaatgtaaaa 11156456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 20848489 - 20848552
Alignment:
399 gggcatgtcacactacattttcaaa--tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||| ||||||||  ||||| |||||||||||||||  ||||||| |||||||||    
20848489 gggcatgtcacactac-ttttcaaaattttcttaaatagaatataaaa--ctatttaataaatatcc 20848552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 52669841 - 52669793
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaact 326  Q
    ||||||| ||||||  ||||||||||||||||| ||||||| |||||||    
52669841 aagagaagtgatatttgtacaaccattttgtgacaacttctggacaact 52669793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0088 (Bit Score: 177; Significance: 4e-95; HSPs: 1)
Name: scaffold0088
Description:

Target: scaffold0088; HSP #1
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 26143 - 25904
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||    
26143 tgtaacaccccattcccaaatataatttatttaa-taaaataaacacacatcagagtaataaatccaaatgggcatgtcacacttcattttcaaatttct 26045  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
    |||||||||||||||||||||||||||||| |||||| |||| | || |||||||||||||||||||||||||| |||||||||||||||||||||| ||    
26044 gaaatagaatataaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatcatcgaaacgtcaacaactatttaaacct 25945  T
529 ccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    ||||||||||||||||||| |||||||||||||||||||||    
25944 ccaaataatatcttggcataaaaagcctcaaccagaataat 25904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 170; Significance: 6e-91; HSPs: 45)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 6e-91
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 12592419 - 12592179
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatttc 427  Q
    |||||||||||||| |||||||||||||||| ||||||| ||| || |||||||||| ||||| ||||||||||||||||||||| ||||||||||||||    
12592419 tgtaacaccccattcccaaatatactttattaaaataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaatttc 12592321  T
428 tgaaatagaatataaaaatctatttattaaatatccaacgaaac-cgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaa 526  Q
    ||||||||||||||||||||||||||| |||||||||| ||||  ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||    
12592320 tgaaatagaatataaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggagtattatcattggaacgtcaacaactatttaaaa 12592221  T
527 ctccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
12592220 ctccaaacaatatcttggcataaaagcctcaaccagaataat 12592179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 331 - 568
Target Start/End: Complemental strand, 16928427 - 16928187
Alignment:
331 taacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttctga 430  Q
    |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
16928427 taacaccccatttccaaatataatttatttaaataaaataaacacacatcagagtaataaatccaaatgggcatgtcacactacattttcaaatttctga 16928328  T
431 aatagaatata-aaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaactc 529  Q
    ||||||||||| ||||||||||||||||| |||||  |||| | || |||||||||||||||||||||||||  ||||||||||||||| |||||| |||    
16928327 aatagaatataaaaaatctatttattaaacatccattgaaatcatcatttaatatgcagcggaatattatcaacgaaacgtcaacaactgtttaaacctc 16928228  T
530 c-aaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    | ||||||||||| ||||| |||||||||||||||||||||    
16928227 caaaataatatctcggcataaaaagcctcaaccagaataat 16928187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 328 - 568
Target Start/End: Original strand, 13005689 - 13005938
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttc 427  Q
    ||||||||||||||| ||||||||| ||||||||| |||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||    
13005689 ttgtaacaccccattcccaaatataatttatttaa-taaaataaacacacatcagagtaataaatcga-atgggcatgtcacactacattttcaaatttc 13005786  T
428 tgaaatagaatata----------aaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaac 517  Q
    ||||||||||||||          ||||||||||||||||| || ||| |||| | || |||||||||||||||||||||||||| ||||||||||||||    
13005787 tgaaatagaatatataaaaaaggaaaaatctatttattaaacattcaatgaaatcatcatttaatatgcagcggaatattatcatcgaaacgtcaacaac 13005886  T
518 tatttaaaactccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    | |||||| ||||||||||||||||||||| |||||||||||||||||||||    
13005887 tgtttaaatctccaaataatatcttggcataaaaagcctcaaccagaataat 13005938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 26295517 - 26295364
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||  ||||||| ||||| ||||||||||||||||||||||||||||| ||||||  ||| | || ||||||  |||||||||||||    
26295517 gggcatgtcacactactatttcaaaatttctaaaatagaatataaaaatctatttattaaacatccaataaaatcatcatttaattagcagcggaatatt 26295418  T
498 atcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    |||||  |||| ||||||||| |||||| |||| ||||||||| ||||||||||    
26295417 atcatcaaaacatcaacaactgtttaaacctccaaaataatatattggcataaa 26295364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 328 - 426
Target Start/End: Complemental strand, 12711688 - 12711592
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    ||||||||||||||| ||||||||| ||||||| |||||||||| | |||||||||||||||| || | |||||||||||||||| | |||||||||||    
12711688 ttgtaacaccccattcccaaatataatttattt-aataaaataaacgcacatcagagtaataattcta-atgggcatgtcacacttcgttttcaaattt 12711592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 426
Target Start/End: Complemental strand, 13124757 - 13124662
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    |||||||||||||| ||||||||| ||||||| |||||||||| | |||||||||||||||| || | |||||||||||||||| | |||||||||||    
13124757 tgtaacaccccattcccaaatataatttattt-aataaaataaacgcacatcagagtaataattcta-atgggcatgtcacacttcgttttcaaattt 13124662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 399 - 502
Target Start/End: Complemental strand, 37245097 - 37244995
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||| ||||| ||||| | || ||||||  |||||||||||||    
37245097 gggcatgtcacactacattttcaaaatttct-aaatagaatataaaaa-ctatttattaaacatccatcgaaatcatcatttaattagcagcggaatatt 37245000  T
498 atcat 502  Q
     ||||    
37244999 ctcat 37244995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 399 - 551
Target Start/End: Complemental strand, 16953022 - 16952869
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||||||||| ||||| | || ||||    ||||| |||||||    
16953022 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaatatccatcgaaatcatcatttatgtagcagcagaatatt 16952924  T
498 atcattgaaacgtcaacaactatttaaaactcca-aataatatcttggcataaaa 551  Q
     ||||  ||||  ||| |||| ||| || ||||| ||||| ||||||||||||||    
16952923 ctcatcaaaacaacaataactgttttaatctccataataaaatcttggcataaaa 16952869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 373 - 458
Target Start/End: Complemental strand, 18959244 - 18959162
Alignment:
373 cacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||  || ||| | ||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||    
18959244 cacacatcagagtaa--aacccaaacgggcatgtcacactacattttcaaaattcttaaatagaatataaaaa-ctatttattaaa 18959162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 329 - 426
Target Start/End: Original strand, 13741895 - 13741990
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    |||||||||||||| ||||||||| ||||| | |||||||||| | |||||||||||||||| || | |||||||||||||||| | |||||||||||    
13741895 tgtaacaccccattcccaaatataatttatct-aataaaataaacgcacatcagagtaataattcta-atgggcatgtcacacttcgttttcaaattt 13741990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 421 - 547
Target Start/End: Original strand, 46173624 - 46173751
Alignment:
421 aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactat 520  Q
    |||||||| |||||||||||||||||||||||| |||| |||||  |||| |  | ||||||  ||||||||| ||||||||   ||| ||||||||| |    
46173624 aaatttcttaaatagaatataaaaatctatttagtaaacatccagagaaatcaacatttaattagcagcggaaaattatcatcacaacttcaacaactgt 46173723  T
521 ttaaaactcc-aaataatatcttggcat 547  Q
    || || |||| |||||||||||||||||    
46173724 tttaacctccaaaataatatcttggcat 46173751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 10306139 - 10306075
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||||||||    
10306139 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaatatcc 10306075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 399 - 551
Target Start/End: Complemental strand, 16946422 - 16946269
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||| ||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||| ||||| | || |||| |  |||| ||||||||    
16946422 gggcatgttacactacattttcaaaatttcttaaatagaatat-aaaatctatttagtaaacatccatcgaaatcatcatttatttagcagtggaatatt 16946324  T
498 atcattgaaacgtcaacaactatttaaaactcca-aataatatcttggcataaaa 551  Q
     |||   ||||  ||| |||| ||| || ||||| ||||| ||||||||||||||    
16946323 ctcaacaaaacaacaataactgttttaatctccataataaaatcttggcataaaa 16946269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 36306821 - 36306767
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||  || |||||||| ||||||||||||||||||||||||    
36306821 gggcatgtcacactacaactttaaatttcttaaatagaatataaaaatctattta 36306767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 557
Target Start/End: Complemental strand, 4064 - 3902
Alignment:
399 gggcatgtcacactacatttt-caaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||||||||  |||||| | |||||||||||||||| ||||||||| || ||||| ||||| | || |||| |  |||||||||||||    
4064 gggcatgtcacactacattttaaaaatttataaaatagaatataaaaa-ctatttattgaacatccatcgaaatcatcatttatttagcagcggaatatt 3966  T
498 atcattga---aacgtcaacaactatttaaaactcca-aataatatcttggcataaaagcctca 557  Q
     ||||  |   |||  ||||||||||||||  ||||| || | |||| ||||||||||||||||    
3965 ctcatcaaaacaacaacaacaactatttaattctccataaaattatcctggcataaaagcctca 3902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 125314 - 125250
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
125314 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 125250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 10305389 - 10305453
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
10305389 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaaaatcc 10305453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 15338301 - 15338357
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| |||||||  |||||||||||||||||    
15338301 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaaatctattta 15338357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 15711692 - 15711636
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| |||||||  |||||||||||||||||    
15711692 gggcatgtcacactacaatttcaaatttcttaaatagaacatataaaaatctattta 15711636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 16185063 - 16185127
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
16185063 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 16185127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 8775239 - 8775298
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
8775239 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 8775298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 21744490 - 21744431
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
21744490 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 21744431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 46349468 - 46349409
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||| ||||||| ||||    
46349468 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaaa-ctatttaataaa 46349409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 445
Target Start/End: Complemental strand, 3290494 - 3290447
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaa 445  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||||    
3290494 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaaa 3290447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 11395410 - 11395356
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
11395410 gggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctattta 11395356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 3327188 - 3327234
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||    
3327188 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaa 3327234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 15086776 - 15086730
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||    
15086776 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaa 15086730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 15723918 - 15723861
Alignment:
399 gggcatgtcacactaca-ttttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| ||||||||||||| |||||||  |||||||||||||||||    
15723918 gggcatgtcacactacaattttcaaatttcttaaatagaacatataaaaatctattta 15723861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 279 - 328
Target Start/End: Original strand, 19426579 - 19426628
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||||||||||| ||||| |||||||||||    
19426579 agagaaatgatatttgtacaaccattttgtgacaactttttgacaacttt 19426628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 38827153 - 38827217
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||| | ||||||||||| |||||||||||| |||| ||||    
38827153 gggcatgtcacactacattttcaaaatttgttaaatagaatat-aaaatctatttaataaaaatcc 38827217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 399 - 497
Target Start/End: Original strand, 6411287 - 6411386
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctattt-attaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||| |||| |||||||| ||||||||||| ||||||||||| |||||| ||||  | ||| | || |||||  |||||||||||||    
6411287 gggcatgtcacactacaatttcaaaatttcttaaatagaatat-aaaatctatttaattaaacatccttcaaaatcatcatttaacttgcagcggaatat 6411385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 33223602 - 33223554
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaact 326  Q
    |||| |||||||||  ||||||||||||||||| |||||||||||||||    
33223602 aagaaaaatgatatttgtacaaccattttgtgacaacttcttgacaact 33223554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 10308712 - 10308666
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| |||||| | |||||||||||||||    
10308712 gggcatgtcacactacattttcaaaatttgttaaatagaatataaaa 10308666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 42060654 - 42060704
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||  ||||||| |||||||||||    
42060654 aagagaaatgatatttgtacaaccattttgctataactttttgacaacttt 42060704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 316
Target Start/End: Original strand, 44511137 - 44511175
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataactt 316  Q
    |||||||||||||| |||||||||||||||||| |||||    
44511137 aagagaaatgatattcgtacaaccattttgtgacaactt 44511175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 12694049 - 12694094
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
12694049 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 12694094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 13677734 - 13677779
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    ||||||||||| ||| ||||| |||||||| |||||||||||||||    
13677734 gggcatgtcacgctaaattttaaaatttcttaaatagaatataaaa 13677779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 15098678 - 15098633
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
15098678 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 15098633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Original strand, 23761058 - 23761107
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||| ||||| | ||||| ||||||||| |||||||||||    
23761058 agagaaatgatatatgtacatcgattttttgataactttttgacaacttt 23761107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 46624308 - 46624353
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
46624308 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 46624353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 403 - 444
Target Start/End: Complemental strand, 46682914 - 46682873
Alignment:
403 atgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||| |||| |||||||| |||||||||||||||    
46682914 atgtcacactactttttaaaatttcttaaatagaatataaaa 46682873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 20406541 - 20406589
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  |||||||||| |||||| ||||| |||||||||||    
20406541 gagaaatgatatttgtacaaccatcttgtgacaactttttgacaacttt 20406589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 484 - 559
Target Start/End: Original strand, 23518284 - 23518359
Alignment:
484 tgcagcggaatattatcattgaaacgtcaacaactatttaaaactccaaa-taatatcttggcataaaagcctcaac 559  Q
    |||||| ||||||||||||  |||| |||||||   |||||| ||||||| || |||||||||||||||||||||||    
23518284 tgcagcagaatattatcatc-aaacatcaacaatagtttaaacctccaaaatattatcttggcataaaagcctcaac 23518359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 316
Target Start/End: Original strand, 29763830 - 29763866
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataactt 316  Q
    ||||||||||||  |||||||||||||||||||||||    
29763830 gagaaatgatatttgtacaaccattttgtgataactt 29763866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 32770805 - 32770864
Alignment:
399 gggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaa 458  Q
    ||||||||||||||||||||||||   |||| |||||||||||||||| ||||||| ||||    
32770805 gggcatgtcacactacattttcaagcattcttaaatagaatataaaaa-ctatttaataaa 32770864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 169; Significance: 2e-90; HSPs: 46)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 329 - 568
Target Start/End: Original strand, 17052991 - 17053230
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
17052991 tgtaacaccccattcccaaatataatttatttaaataaaataaacacacatcagagtaataaatccaaatgggcatgtcacactacattttcaaatttct 17053090  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
    |||||||||||||||||||||||||||||| |||||| |||| | || |||||||||||||||||||||||||  ||||||||||||||| ||| || ||    
17053091 gaaatagaatataaaaatctatttattaaacatccaatgaaatcatcatttaatatgcagcggaatattatcaacgaaacgtcaacaactgttt-aacct 17053189  T
529 cc-aaataatatcttggcataaaagcctcaaccagaataat 568  Q
    || ||||||||||| ||||||||||||||||||||||||||    
17053190 ccaaaataatatctcggcataaaagcctcaaccagaataat 17053230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 23824456 - 23824608
Alignment:
399 gggcatgtcacactacattttcaaa--tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    |||||||||||||||||||||||||  ||||| |||||||||||||||  ||||||| |||| |||||| || | | || ||||||  ||||||||||||    
23824456 gggcatgtcacactacattttcaaatttttcttaaatagaatataaaa--ctatttaataaacatccaatgagatcatcatttaattagcagcggaatat 23824553  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
     |||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
23824554 aatcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 23824608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 329 - 426
Target Start/End: Original strand, 25408972 - 25409068
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    |||||||||||||| ||||||||| ||||||||| |||||||  |||||||||||||||||| | || |||||||||||||||| |||||||||||||    
25408972 tgtaacaccccattcccaaatataatttatttaa-taaaatatacacacatcagagtaataacttcaaatgggcatgtcacacttcattttcaaattt 25409068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 327 - 426
Target Start/End: Complemental strand, 19903719 - 19903622
Alignment:
327 tttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    |||||||||||||||| ||||||||| ||||||| |||||||||| | |||||||||||||||| |||| |||||||||||||||| | |||||||||||    
19903719 tttgtaacaccccattcccaaatataatttattt-aataaaataaacgcacatcagagtaataattcca-atgggcatgtcacacttcgttttcaaattt 19903622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 29327483 - 29327635
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    |||||||  |||||||||||  |||||||| |||||||||||||||||||||||| |||| |||||  |||| |  | ||||||  ||||||||| ||||    
29327483 gggcatgctacactacatttcaaaatttcttaaatagaatataaaaatctatttactaaacatccagagaaatcaacatttaattagcagcggaaaatta 29327582  T
499 tcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||   ||| ||||||||| ||| || |||| ||||||||||||||||||||    
29327583 tcatcacaacttcaacaactgttttaacctccaaaataatatcttggcataaa 29327635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 399 - 559
Target Start/End: Original strand, 27889314 - 27889475
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||  | ||||| ||||| |||||||||||||| ||  |||||||||| |||||| |||| | || |||||   ||| | |||||||    
27889314 gggcatgtcacactactatatcaaaatttcttaaatagaatataaatattcatttattaaacatccaatgaaatcatcatttaaacagcaccagaatatt 27889413  T
498 atcattgaaacgtcaacaactattt-aaaactccaaataatatcttggcataaaagcctcaac 559  Q
    ||   | |||| ||||||||||||| ||||||||||| ||||||||||||| |||||||||||    
27889414 attcatcaaacatcaacaactattttaaaactccaaacaatatcttggcat-aaagcctcaac 27889475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 399 - 559
Target Start/End: Original strand, 27947972 - 27948133
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||  | ||||| ||||| |||||||||||||| ||  |||||||||| |||||| |||| | || |||||   ||| | |||||||    
27947972 gggcatgtcacactactatatcaaaatttcttaaatagaatataaatattcatttattaaacatccaatgaaatcatcatttaaacagcaccagaatatt 27948071  T
498 atcattgaaacgtcaacaactattt-aaaactccaaataatatcttggcataaaagcctcaac 559  Q
    ||   | |||| ||||||||||||| ||||||||||| ||||||||||||| |||||||||||    
27948072 attcatcaaacatcaacaactattttaaaactccaaacaatatcttggcat-aaagcctcaac 27948133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 329 - 422
Target Start/End: Original strand, 23864834 - 23864925
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaa 422  Q
    |||||||||||||| ||||||||| ||||||| |||||||||| | |||||||||||||||| || | |||||||||||||||| | |||||||    
23864834 tgtaacaccccattcccaaatataatttattt-aataaaataaacgcacatcagagtaataattcta-atgggcatgtcacacttcgttttcaa 23864925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 399 - 555
Target Start/End: Complemental strand, 22176607 - 22176450
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| | || ||||| |  || | || |||| |  |||||||||||||    
22176607 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaatgaacatccatcagaatcatcatttatttagcagcggaatatt 22176509  T
498 atcattgaaacgtcaacaactatttaaaactcca-aataatatcttggcataaaagcct 555  Q
     ||||  ||||  |||||||| |||||| ||||| | ||| || |||||||||||||||    
22176508 ctcatcaaaacaacaacaactgtttaaacctccatagtaaaatattggcataaaagcct 22176450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 22064301 - 22064245
Alignment:
399 gggcatgtcacactacattttcaaa--tttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||||||||||  ||||| ||||||||||||||||||||||||    
22064301 gggcatgtcacactacattttcaaaattttcttaaatagaatataaaaatctattta 22064245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 22248483 - 22248547
Alignment:
399 gggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||||||||    
22248483 gggcatgtcacactacattttcaagatttcttaaatagaatat-aaaatctatttaataaatatcc 22248547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 399 - 502
Target Start/End: Complemental strand, 31419458 - 31419356
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||| | ||||| ||||| | || |||| |  |||||||||||||    
31419458 gggcatgtcacactacattttcaaaatttct-aaatagaatataaaaa-ctatttattacacatccatcgaaatcatcatttatttagcagcggaatatt 31419361  T
498 atcat 502  Q
     ||||    
31419360 ctcat 31419356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 21281452 - 21281506
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||| || ||| |||||||| ||||||||||||||||||||||||    
21281452 gggcatgtcacacttcaattttaaatttcttaaatagaatataaaaatctattta 21281506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 7302327 - 7302263
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
7302327 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 7302263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 21322965 - 21322901
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
21322965 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 21322901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 21327553 - 21327489
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
21327553 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 21327489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 36601092 - 36601156
Alignment:
399 gggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||| ||||    
36601092 gggcatgtcacactacattttcaagatttcttaaatagaatat-aaaatctatttaataaacatcc 36601156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 44494757 - 44494693
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||| |||| ||||    
44494757 gggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctatttaataaacatcc 44494693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 502
Target Start/End: Complemental strand, 31413019 - 31412917
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||||||||| |||||||| ||||| |||||||||| |||||||||| | ||||| ||||| | || |||| |  |||||||||||||    
31413019 gggcatgtcacactacattttcaaaatttct-aaatataatataaaaa-ctatttattacacatccatcgaaaacatcatttatttagcagcggaatatt 31412922  T
498 atcat 502  Q
     ||||    
31412921 ctcat 31412917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 39021516 - 39021468
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaact 326  Q
    ||||||||||||||  ||||||||||||||||||||||| |||||||||    
39021516 aagagaaatgatatttgtacaaccattttgtgataactttttgacaact 39021468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 400 - 463
Target Start/End: Original strand, 44430844 - 44430907
Alignment:
400 ggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
44430844 ggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 44430907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 45136111 - 45136052
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
45136111 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 45136052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 6609426 - 6609372
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||    
6609426 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctattta 6609372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 278 - 329
Target Start/End: Complemental strand, 22852912 - 22852861
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaactttt 329  Q
    ||||||||||||||  ||||||||| ||||||| ||||||||||||||||||    
22852912 aagagaaatgatatttgtacaaccactttgtgacaacttcttgacaactttt 22852861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 28852895 - 28852949
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||    
28852895 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctattta 28852949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 11223932 - 11223882
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||| ||||||||||| |||||||||||||||||    
11223932 aagagaaatgatatttgtacatccattttgtgacaacttcttgacaacttt 11223882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 21300892 - 21300846
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||    
21300892 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaa 21300846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 22989030 - 22989084
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||| |||| |||  |||||||| ||||||||||||||||||||||||    
22989030 gggcatgtcacgctacttttcaaaatttcttaaatagaatataaaaatctattta 22989084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 40842012 - 40842062
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||| ||||||||||||| |||||||||||    
40842012 aagagaaatgatatttgtacaaccactttgtgataactttttgacaacttt 40842062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 19988915 - 19988868
Alignment:
399 gggcatgtcacactacatttt--caaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||  ||||||||| |||||||||||||||    
19988915 gggcatgtcacactacattttcacaaatttcttaaatagaatataaaa 19988868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 21273781 - 21273737
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    ||||||||||||  ||||||||||||||||| |||||||||||||    
21273781 gagaaatgatatttgtacaaccattttgtgacaacttcttgacaa 21273737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 28623182 - 28623134
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||||| ||||||||||| |||||||||||    
28623182 gagaaatgatatttgtacaaccattatgtgataactttttgacaacttt 28623134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 324
Target Start/End: Original strand, 26294186 - 26294233
Alignment:
277 caagagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    |||||||||||||||  ||||||||||||||||| ||||| |||||||    
26294186 caagagaaatgatattggtacaaccattttgtgacaactttttgacaa 26294233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 324
Target Start/End: Original strand, 26307443 - 26307490
Alignment:
277 caagagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    |||||||||||||||  ||||||||||||||||| ||||| |||||||    
26307443 caagagaaatgatattggtacaaccattttgtgacaactttttgacaa 26307490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 402 - 463
Target Start/End: Original strand, 11773703 - 11773764
Alignment:
402 catgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||| |||||||||||||||| |||||| ||||||||||| |||||||||||| |||| ||||    
11773703 catgacacactacattttcaagatttcttaaatagaatat-aaaatctatttaataaacatcc 11773764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 34949629 - 34949695
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaat-ataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||||||||||| ||||  ||||||||| | ||||||||||||| |||| ||||    
34949629 gggcatgtcacactacattttcaaattttcataaatagaataaaaaaaatctatttaataaacatcc 34949695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 45101394 - 45101444
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
45101394 aagagaaatgatatttgtacaaccactttgtgacaactttttgacaacttt 45101444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 5239471 - 5239535
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||| |||||| ||||| ||||| |||||||||||||||| ||||||| |||| ||||    
5239471 gggcatgtcacaatacattatcaaaatttcttaaatagaatataaaaa-ctatttaataaacatcc 5239535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 328
Target Start/End: Complemental strand, 11879566 - 11879513
Alignment:
275 atcaagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||||||| ||||  ||| ||||||| ||||| |||||||||||    
11879566 atcaagagaaatgatatatgtacgtccactttgtgacaactttttgacaacttt 11879513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 328
Target Start/End: Complemental strand, 11896982 - 11896929
Alignment:
275 atcaagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||||||| ||||  ||| ||||||| ||||| |||||||||||    
11896982 atcaagagaaatgatatatgtacgtccactttgtgacaactttttgacaacttt 11896929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 19852944 - 19852989
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
19852944 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 19852989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 19858980 - 19859025
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
19858980 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 19859025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 20005804 - 20005849
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
20005804 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 20005849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 453
Target Start/End: Complemental strand, 22026290 - 22026242
Alignment:
407 cacactacattttcaaa--tttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||  ||||| ||||||||||| ||||||||||||    
22026290 cacactacattttcaaaattttcttaaatagaatatgaaaatctattta 22026242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 37873177 - 37873128
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||| ||||||||| ||||||||| |||||||||||    
37873177 agagaaatgatatttgtaaaaccattttatgataactttttgacaacttt 37873128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 377 - 444
Target Start/End: Original strand, 18609569 - 18609637
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    ||||||||||||||  | | | |||||||||||||| ||||||| |||||||  |||||||||||||||    
18609569 catcagagtaataacccaaaacgggcatgtcacacttcattttcaaaatttcgtaaatagaatataaaa 18609637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 164; Significance: 2e-87; HSPs: 33)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 328 - 568
Target Start/End: Complemental strand, 5707800 - 5707559
Alignment:
328 ttgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaattt 426  Q
    ||||||||||||||| ||| |||||||||||||||||||| ||| || |||||||||| ||||| ||||||||||||||||||||| |||||||||||||    
5707800 ttgtaacaccccattcccatatatactttatttaaataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaattt 5707702  T
427 ctgaaatagaatataaaaatctatttattaaatatccaacg-aaaccgtcgtttaatatgcagcggaatattatcattg-aaacgtcaacaactatttaa 524  Q
    |||||||||||||||||||||||||||| |||||||||| | ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
5707701 ctgaaatagaatataaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcattgaaaacgtcaacaactatttaa 5707602  T
525 aactccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    ||||||||| |||||||||||||||||||| |||||||||||||    
5707601 aactccaaacaatatcttggcataaaagcc-caaccagaataat 5707559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 401 - 550
Target Start/End: Complemental strand, 21134067 - 21133917
Alignment:
401 gcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatc 500  Q
    |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| | || ||||||  ||||||||||||||||    
21134067 gcatgtcatactacattttcaaatttctaaaatagaatataaaaatctatttattaaatatccaatgaaatcatcatttaattagcagcggaatattatc 21133968  T
501 attgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
21133967 atcaaaacatcaacaactctttaaacctccaaaataatatcttggcataaa 21133917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 400 - 550
Target Start/End: Original strand, 36799947 - 36800099
Alignment:
400 ggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattat 499  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||| |||| | || |||| |  |||||||||||||||    
36799947 ggcatgtcacactacattttcaaatttctaaaatagaatataaaaatctatttattaaacattcaatgaaatcatcatttacttagcagcggaatattat 36800046  T
500 cattgaaacgtcaacaactatttaaaa-ctcc-aaataatatcttggcataaa 550  Q
    |||  |||| ||||||||| ||||||| |||| ||| ||||||||||||||||    
36800047 catcaaaacatcaacaactgtttaaaacctccaaaagaatatcttggcataaa 36800099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 43692777 - 43692929
Alignment:
399 gggcatgtcacactacattttcaaattt--ctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||||||||||||||  || |||||||||||||||  ||||||| |||| |||||| |||| | || ||||||  ||||||||||||    
43692777 gggcatgtcacactacattttcaaatttttcttaaatagaatataaaa--ctatttaataaacatccaatgaaatcatcatttaattagcagcggaatat 43692874  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
43692875 tatcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 43692929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 25590886 - 25590735
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||  | ||||| ||||| ||||||||||||||||||||||||||||| |||||| |||| | ||  || ||  |||||||||||||    
25590886 gggcatgtcacactactatatcaaaatttcttaaatagaatataaaaatctatttattaaacatccaatgaaatcatcaatttattagcagcggaatatt 25590787  T
498 atcattgaaacgtcaacaactatttaaaactccaaataatatcttggcataaa 550  Q
    |||| | |||| ||||||| | |||||| ||||||||||||||||||||||||    
25590786 atca-tcaaacatcaacaattgtttaaacctccaaataatatcttggcataaa 25590735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 27368324 - 27368172
Alignment:
399 gggcatgtcacactacattttcaaattt--ctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||||||| ||||||  || |||||||||||||||  ||||||| |||| |||||| |||| |||| ||||||  ||||||||||||    
27368324 gggcatgtcacactacatttttaaatttttcttaaatagaatataaaa--ctatttaataaacatccaatgaaatcgtcatttaattagcagcggaatat 27368227  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||  |||| ||||||||| |||||  |||| ||||||||||||||||||||    
27368226 tatcatcaaaacatcaacaactgtttaagcctccaaaataatatcttggcataaa 27368172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 399 - 555
Target Start/End: Original strand, 22809354 - 22809511
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||| | ||| | || |||| |  |||||||||||||    
22809354 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatccatcaaaatcatcatttatttagcagcggaatatt 22809452  T
498 atcattgaaacgtcaacaactatttaaaactcca-aataatatcttggcataaaagcct 555  Q
     ||||  ||||  |||||||| |||||| ||||| |||||  || ||||||||||||||    
22809453 ctcatcaaaacaacaacaactgtttaaacctccataataaattcctggcataaaagcct 22809511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 426
Target Start/End: Original strand, 26582066 - 26582161
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    |||||||||  ||| ||||||||| ||||||||| |||||||  |||||||||||||||||| | || |||||||||||| ||| |||||||||||||    
26582066 tgtaacaccttattcccaaatataatttatttaa-taaaatatacacacatcagagtaataatttca-atgggcatgtcatacttcattttcaaattt 26582161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 6031629 - 6031693
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
6031629 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 6031693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 20964716 - 20964652
Alignment:
399 gggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||| ||||    
20964716 gggcatgtcacactacattttcaagatttcttaaatagaatat-aaaatctatttaataaacatcc 20964652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 24503659 - 24503723
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
24503659 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 24503723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 25036806 - 25036742
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
25036806 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 25036742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 25040913 - 25040849
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
25040913 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 25040849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 31754915 - 31754979
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
31754915 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 31754979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 444
Target Start/End: Original strand, 23061933 - 23062000
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttca-aatttctgaaatagaatataaaa 444  Q
    ||||||||||||||  ||| | ||||||||||||||||||||||| ||||||| |||||||||||||||    
23061933 catcagagtaataac-ccaaacgggcatgtcacactacattttcataatttcttaaatagaatataaaa 23062000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 23029748 - 23029694
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
23029748 gggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctattta 23029694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 393 - 463
Target Start/End: Complemental strand, 25108193 - 25108123
Alignment:
393 ccacatgggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||| |||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||| |||| ||||    
25108193 ccacacgggcatgtcacactacattttcaaaatttcttaaattgaatataaaaa-ctatttaataaacatcc 25108123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 280 - 326
Target Start/End: Complemental strand, 39247534 - 39247488
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaact 326  Q
    ||||||||||||  ||||||||||||||||||||||| |||||||||    
39247534 gagaaatgatatttgtacaaccattttgtgataactttttgacaact 39247488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 281 - 324
Target Start/End: Complemental strand, 26321767 - 26321724
Alignment:
281 agaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    |||||||||||  ||||||||||||||||||||||| |||||||    
26321767 agaaatgatatttgtacaaccattttgtgataactttttgacaa 26321724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 281 - 324
Target Start/End: Complemental strand, 26321935 - 26321892
Alignment:
281 agaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    |||||||||||  ||||||||||||||||||||||| |||||||    
26321935 agaaatgatatttgtacaaccattttgtgataactttttgacaa 26321892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 5954556 - 5954506
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||| ||||||||||| | |||||||||    
5954556 aagagaaatgatatttgtacaaccattatgtgataacttttggacaacttt 5954506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 11229394 - 11229344
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||| ||| ||||||| |||||||||||||||||    
11229394 aagagaaatgatatttgtacatccactttgtgacaacttcttgacaacttt 11229344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 21906700 - 21906746
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||| ||||||| |||||||| |||||||||||||||    
21906700 gggcatgtcacacttcattttcaaaatttcttaaatagaatataaaa 21906746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 534 - 564
Target Start/End: Complemental strand, 23169873 - 23169843
Alignment:
534 taatatcttggcataaaagcctcaaccagaa 564  Q
    |||||||||||||||||||||||||||||||    
23169873 taatatcttggcataaaagcctcaaccagaa 23169843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 377 - 443
Target Start/End: Original strand, 23263414 - 23263479
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttcaaatttctgaaatagaatataaa 443  Q
    ||||||||||||||  ||| | |||||||||||||||| |||  |||||||| ||||||||||||||    
23263414 catcagagtaataac-ccaaacgggcatgtcacactacttttcaaaatttcttaaatagaatataaa 23263479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 377 - 443
Target Start/End: Original strand, 23268630 - 23268695
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactacattttcaaatttctgaaatagaatataaa 443  Q
    ||||||||||||||  ||| | |||||||||||||||| |||  |||||||| ||||||||||||||    
23268630 catcagagtaataac-ccaaacgggcatgtcacactacttttcaaaatttcttaaatagaatataaa 23268695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 534 - 564
Target Start/End: Complemental strand, 23581130 - 23581100
Alignment:
534 taatatcttggcataaaagcctcaaccagaa 564  Q
    |||||||||||||||||||||||||||||||    
23581130 taatatcttggcataaaagcctcaaccagaa 23581100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 31296918 - 31296868
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||||| ||| | |||||||||||    
31296918 aagagaaatgatatttgtacaaccattttgtgacaacgttttgacaacttt 31296868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 278 - 327
Target Start/End: Complemental strand, 4738645 - 4738596
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaactt 327  Q
    ||||||||||||||  ||||||||| ||||||| ||||| ||||||||||    
4738645 aagagaaatgatatttgtacaaccactttgtgacaactttttgacaactt 4738596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 278 - 327
Target Start/End: Complemental strand, 33296144 - 33296095
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaactt 327  Q
    ||||||||||||||  ||||||||| ||||||| ||||| ||||||||||    
33296144 aagagaaatgatatttgtacaaccactttgtgacaactttttgacaactt 33296095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 36909915 - 36909866
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||||||||||| ||||| | |||||||||    
36909915 agagaaatgatatttgtacaaccattttgtgacaacttttggacaacttt 36909866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 316
Target Start/End: Original strand, 3039864 - 3039900
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataactt 316  Q
    |||||||||||| |||||||| |||||||||||||||    
3039864 gagaaatgatattcgtacaactattttgtgataactt 3039900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 3091741 - 3091785
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    ||||||||||||  ||||||| ||||||||||||||| |||||||    
3091741 gagaaatgatatttgtacaactattttgtgataactttttgacaa 3091785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0730 (Bit Score: 159; Significance: 2e-84; HSPs: 1)
Name: scaffold0730
Description:

Target: scaffold0730; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 4551 - 4306
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatttc 427  Q
    |||||||||||||| || ||||||||||||||| ||||| ||| || |||||||||| ||||| ||||||||||||||||||||| ||||||||||||||    
4551 tgtaacaccccattcccgaatatactttatttagataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaatttc 4453  T
428 tgaaatagaatata-----aaaatctatttattaaatatccaacgaaac-cgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatt 521  Q
    ||||||||||||||     ||||||||||||| |||||||||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||    
4452 tgaaatagaatatatataaaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatt 4353  T
522 taaaactccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||    
4352 taaaactccaaacaatatcttggcataaaagcctcaaccagaataat 4306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0148 (Bit Score: 159; Significance: 2e-84; HSPs: 1)
Name: scaffold0148
Description:

Target: scaffold0148; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 338 - 93
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatttc 427  Q
    |||||||||||||| || ||||||||||||||| ||||| ||| || |||||||||| ||||| ||||||||||||||||||||| ||||||||||||||    
338 tgtaacaccccattcccgaatatactttatttagataaa-taaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaatttc 240  T
428 tgaaatagaatata-----aaaatctatttattaaatatccaacgaaac-cgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatt 521  Q
    ||||||||||||||     ||||||||||||| |||||||||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||    
239 tgaaatagaatatatataaaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatt 140  T
522 taaaactccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||    
139 taaaactccaaacaatatcttggcataaaagcctcaaccagaataat 93  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 158; Significance: 8e-84; HSPs: 41)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 329 - 568
Target Start/End: Original strand, 23526838 - 23527079
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||    
23526838 tgtaacacccgattcccaaatatactttatttaaataaaataaacacacatcagagtaataaatccaaatgggcatgtcacactacaatttcaaatttct 23526937  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaac- 527  Q
    | |||||||||||||||||||||| ||||| |||||| |||| | || |||||||||||||||||||||||||| |||||||| |||||| |||||| |     
23526938 ggaatagaatataaaaatctatttgttaaacatccaatgaaatcatcatttaatatgcagcggaatattatcatcgaaacgtcgacaactgtttaaacct 23527037  T
528 tccaaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    || ||||||||||||||||| |||||||||||||||||||||    
23527038 tcaaaataatatcttggcataaaaagcctcaaccagaataat 23527079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 21676275 - 21676123
Alignment:
399 gggcatgtcacactacattttcaaattt--ctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||||||||||||||  || |||||||||||||||  ||||||| |||| |||||| |||| | || ||||||  ||||||||||||    
21676275 gggcatgtcacactacattttcaaatttttcttaaatagaatataaaa--ctatttaataaacatccaatgaaatcatcatttaattagcagcggaatat 21676178  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
21676177 tatcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 21676123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 397 - 550
Target Start/End: Complemental strand, 42242510 - 42242356
Alignment:
397 atgggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    |||||||||  |||||||||||  || ||||| |||||||||||||||||||||||| |||| |||||  |||| |  | ||||||  ||||||||| ||    
42242510 atgggcatgctacactacatttcaaagtttcttaaatagaatataaaaatctatttactaaacatccagagaaatcaacatttaattagcagcggaaaat 42242411  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||   ||| ||||||||| ||| || |||| ||||||||||||||||||||    
42242410 tatcatcacaacttcaacaactgttttaacctccaaaataatatcttggcataaa 42242356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 22509869 - 22509813
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaa--tataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||||||  ||||||||||||||||    
22509869 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaaatctattta 22509813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 22759916 - 22759852
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
22759916 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 22759852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 22880006 - 22880070
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
22880006 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 22880070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 24669742 - 24669686
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaa--tataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||||||  ||||||||||||||||    
24669742 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaaatctattta 24669686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 24739511 - 24739455
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaa--tataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||||||  ||||||||||||||||    
24739511 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaaatctattta 24739455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 24752280 - 24752224
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaa--tataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||||||  ||||||||||||||||    
24752280 gggcatgtcacactacaatttcaaatttcttaaatagaatatataaaaatctattta 24752224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 33474606 - 33474542
Alignment:
399 gggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||| ||||    
33474606 gggcatgtcacactacattttcaagatttcttaaatagaatat-aaaatctatttaataaacatcc 33474542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 43120151 - 43120210
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
43120151 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 43120210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 19075436 - 19075490
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
19075436 gggcatgtcacactacattttcaaattttcttaaatagaatat-aaaatctattta 19075490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 445
Target Start/End: Original strand, 21661816 - 21661863
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaa 445  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||||||    
21661816 gggcatgtcacactacattttcaaattttcttaaatagaatataaaaa 21661863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 26660484 - 26660434
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||| ||||||||||| |||||||||||||||||    
26660484 aagagaaatgatatttgtacatccattttgtgacaacttcttgacaacttt 26660434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 26932076 - 26932026
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||| ||||||||||| |||||||||||||||||    
26932076 aagagaaatgatatttgtacatccattttgtgacaacttcttgacaacttt 26932026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 441
Target Start/End: Complemental strand, 30344864 - 30344822
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatata 441  Q
    ||||||||||||||||| |||||||||||| ||||||||||||    
30344864 gggcatgtcacactacaatttcaaatttcttaaatagaatata 30344822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 758966 - 758910
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaataga--atataaaaatctattta 453  Q
    ||||||||||||||||| |||||||||||| ||||| |  |||||||||||||||||    
758966 gggcatgtcacactacaatttcaaatttcttaaataaaatatataaaaatctattta 758910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 23433565 - 23433520
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||| |||||||| |||||||||||||||    
23433565 gggcatgtcacactactttttaaaatttcttaaatagaatataaaa 23433520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 23444930 - 23444885
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||| |||||||| |||||||||||||||    
23444930 gggcatgtcacactactttttaaaatttcttaaatagaatataaaa 23444885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 36713250 - 36713201
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  ||||||||| ||||||| |||||||||||||||||    
36713250 agagaaatgatatttgtacaaccactttgtgacaacttcttgacaacttt 36713201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 43244458 - 43244394
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||| | ||||||||||| |||||||||||| |||| ||||    
43244458 gggcatgtcacactacattttcaaaatttgttaaatagaatat-aaaatctatttaataaaaatcc 43244394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 276 - 328
Target Start/End: Original strand, 14914368 - 14914420
Alignment:
276 tcaagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||||  ||||||||||||||||| ||||| | |||||||||    
14914368 tcaagagaaatgatatttgtacaaccattttgtgacaacttttggacaacttt 14914420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 43123684 - 43123743
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    ||||||||||||||||| |||| |||||||| ||||||||||| |||||||||||| ||||    
43123684 gggcatgtcacactacaatttcaaaatttcttaaatagaatat-aaaatctatttaataaa 43123743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 31253742 - 31253688
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||| |||||||||| ||||| ||||||||||| ||||||||||||    
31253742 gggcatgtcacactccattttcaaattttcttaaatagaatat-aaaatctattta 31253688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 279 - 325
Target Start/End: Complemental strand, 3771078 - 3771032
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaac 325  Q
    |||||||||||||  ||||||||||||||||| ||||| ||||||||    
3771078 agagaaatgatatctgtacaaccattttgtgacaactttttgacaac 3771032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 402 - 463
Target Start/End: Complemental strand, 6728965 - 6728904
Alignment:
402 catgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    ||||||||||||||||||| |||||| | ||||||||||| |||||||||||| |||| ||||    
6728965 catgtcacactacattttcaaaatttattaaatagaatat-aaaatctatttaataaacatcc 6728904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 11768063 - 11768013
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||| ||| ||||||| |||||||||||||||||    
11768063 aagagaaatgatatttgtacatccactttgtgacaacttcttgacaacttt 11768013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 280 - 326
Target Start/End: Original strand, 19127124 - 19127170
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaact 326  Q
    ||||||||||||  ||||||||| ||||||| |||||||||||||||    
19127124 gagaaatgatatttgtacaaccactttgtgacaacttcttgacaact 19127170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 23991207 - 23991157
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||| ||||||| |||||| ||||||||||    
23991207 aagagaaatgatatttgtacaaccactttgtgacaacttcctgacaacttt 23991157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 38500941 - 38500991
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||||| || || |||||||||||    
38500941 aagagaaatgatatttgtacaaccattttgtgacaattttttgacaacttt 38500991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 14324040 - 14323991
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    |||||||||||||  | ||| ||||||||||| |||||||||||||||||    
14324040 agagaaatgatatttgcacatccattttgtgacaacttcttgacaacttt 14323991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 548
Target Start/End: Original strand, 22378920 - 22379072
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaa-tagaatata-aaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaat-a 495  Q
    ||||||||||||||||  ||||||| || | ||| ||||||||| ||||||||||||| ||| ||||||  ||| | || ||||||  |||||||||| |    
22378920 gggcatgtcacactactatttcaaaattttcaaaatagaatatataaaatctatttataaaacatccaataaaatcatcatttaattggcagcggaatta 22379019  T
496 ttatcattgaaacgtcaacaactatttaaaactccaaa-taatatcttggcata 548  Q
    ||| ||| ||| | |||||||||  | |||||| |||| |||||||||||||||    
22379020 ttaacatcgaa-catcaacaactgatcaaaacttcaaaataatatcttggcata 22379072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 25013080 - 25013125
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
25013080 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 25013125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 316
Target Start/End: Original strand, 35814452 - 35814489
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataactt 316  Q
    |||||||||||||  |||||||||||||||||||||||    
35814452 agagaaatgatatttgtacaaccattttgtgataactt 35814489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 12718451 - 12718403
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
12718451 gagaaatgatatttgtacaaccaatttgtgacaactttttgacaacttt 12718403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 12779677 - 12779629
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
12779677 gagaaatgatatttgtacaaccaatttgtgacaactttttgacaacttt 12779629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 400 - 444
Target Start/End: Complemental strand, 21906014 - 21905970
Alignment:
400 ggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    ||||||||||||||| || | |||||||| |||||||||||||||    
21906014 ggcatgtcacactactttctaaaatttcttaaatagaatataaaa 21905970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 484 - 559
Target Start/End: Complemental strand, 28260556 - 28260482
Alignment:
484 tgcagcggaatattatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaaagcctcaac 559  Q
    ||||||||| |||||||||  |||| ||||||| | ||||||||||| ||| ||||||||||||| |||||||||||    
28260556 tgcagcggattattatcatc-aaacatcaacaattgtttaaaactccaaaacaatatcttggcat-aaagcctcaac 28260482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 34381012 - 34381060
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
34381012 gagaaatgatatttgtacaaccactttgtgacaactttttgacaacttt 34381060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 39595272 - 39595320
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
39595272 gagaaatgatatttgtacaaccactttgtgacaactttttgacaacttt 39595320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 42699057 - 42699105
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||||||||||| ||||| |||| ||||||    
42699057 gagaaatgatatttgtacaaccattttgtgacaactttttgataacttt 42699105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0693 (Bit Score: 155; Significance: 5e-82; HSPs: 1)
Name: scaffold0693
Description:

Target: scaffold0693; HSP #1
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 329 - 568
Target Start/End: Original strand, 1423 - 1664
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatttc 427  Q
    |||||||||||||| ||| ||||||||||||| ||  |||||| || |||||||||| ||||| ||||||||||||||||||||| ||||||||||||||    
1423 tgtaacaccccattcccatatatactttattttaaataaataaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaatttc 1522  T
428 tgaaatagaatataaaaatctatttattaaatatccaacg-aaaccgtcgtttaatatgcagcggaatattatcattg-aaacgtcaacaactatttaaa 525  Q
    ||||||||||||||||||||||||||| |||||||||| | ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1523 tgaaatagaatataaaaatctatttataaaatatccaaagaaaatcgtcgtttaatatgcagcggaatattatcattgaaaacgtcaacaactatttaaa 1622  T
526 actccaaataatatcttggcataaaagcctcaaccagaataat 568  Q
    |||||||| |||||||||||||||||||| |||||| ||||||    
1623 actccaaacaatatcttggcataaaagcc-caaccaaaataat 1664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125 (Bit Score: 154; Significance: 2e-81; HSPs: 1)
Name: scaffold0125
Description:

Target: scaffold0125; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 329 - 568
Target Start/End: Complemental strand, 24985 - 24744
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttct 428  Q
    |||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||    
24985 tgtaacaccccattcccaaatataatttatttaaataaaataaacacacatcagagtaataaatccaaatgggcatgtcacactatattttcaaatttct 24886  T
429 gaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactatttaaaact 528  Q
    |||||||||||||||||||||||||||||| |||||| |||  | || |||||||||||||||||||||||||  |||| |||||||||| |||||| ||    
24885 gaaatagaatataaaaatctatttattaaacatccaatgaattcatcatttaatatgcagcggaatattatcaacgaaatgtcaacaactgtttaaacct 24786  T
529 cc-aaataatatcttggcat-aaaagcctcaaccagaataat 568  Q
    || |||||||||||  |||| |||||||||||||||||||||    
24785 ccaaaataatatctctgcataaaaagcctcaaccagaataat 24744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 5e-45; HSPs: 55)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 33096429 - 33096581
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||| |||||  || ||||||| ||||||||||||||    
33096429 gggcatgtcacactacattttcagatttctaaaatagaatataaaaatctatttattaaacatccaatgaaactatcatttaataagcagcggaatatta 33096528  T
499 tcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
33096529 tcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 33096581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 470
Target Start/End: Original strand, 53482649 - 53482791
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaa-tccacatgggcatgtcacactacattttcaaatttc 427  Q
    |||||||||||||| ||| ||||||||||||| ||  |||||| || |||||||||| ||||| ||||||||||||||||||||| ||||||||||||||    
53482649 tgtaacaccccattcccatatatactttattttaaataaataaacatacatcagagtcataaaatccacatgggcatgtcacacttcattttcaaatttc 53482748  T
428 tgaaatagaatataaaaatctatttattaaatatccaacgaaa 470  Q
    ||||||||||||||||||||||||||| |||||||||| ||||    
53482749 tgaaatagaatataaaaatctatttataaaatatccaaagaaa 53482791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 37880791 - 37880942
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||| |||||| |||| | || ||||||  ||| |||||||||    
37880791 gggcatgtcagactacattttcaaaatttct-aaatagaatataaaaatctatttgttaaacatccaatgaaatcatcatttaattagca-cggaatatt 37880888  T
498 atcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    |||||  |||| ||||||||| |||||| |||| ||||||||||||||| ||||    
37880889 atcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcgtaaa 37880942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 898994 - 899147
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaa-tagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||  | ||||| ||||| ||| |||||||||||||||||||||||| | |||||  |||| |  | ||||||  ||||||||||||    
898994 gggcatgtcacactactatatcaaaatttcttaaaatagaatataaaaatctatttattacacatccatagaaatcaacatttaatcagcagcggaatat 899093  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||| | |||| ||||||| | |||||| |||| ||||||||||||||||||||    
899094 tatca-tcaaacatcaacaattgtttaaacctccaaaataatatcttggcataaa 899147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 329 - 426
Target Start/End: Complemental strand, 8056408 - 8056313
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    ||||||||| |||| |||||||||  |||||||| |||||||  |||||||||||||||||| | || |||||||||||||||| |||||||||||||    
8056408 tgtaacacctcattcccaaatataaattatttaa-taaaatatacacacatcagagtaataatttca-atgggcatgtcacacttcattttcaaattt 8056313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 392 - 463
Target Start/End: Complemental strand, 41940066 - 41939995
Alignment:
392 tccacatgggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||| |||||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||||||||    
41940066 tccaaatgggcatgtcacactacattttcaagatttcttaaatagaatat-aaaatctatttaataaatatcc 41939995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 399 - 555
Target Start/End: Original strand, 14479926 - 14480083
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||| | ||| |  | |||| |  ||||| |||||||    
14479926 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatccatc-aaatcaccatttatttagcagcagaatatt 14480023  T
498 atcattgaaacgtcaacaactatttaaaa-ctcca-aataatatcttggcataaaagcct 555  Q
     ||||  ||||  |||||||||||||||| ||||| ||||| || |||||||||||||||    
14480024 ctcatcaaaacaacaacaactatttaaaacctccataataaaatattggcataaaagcct 14480083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 399 - 549
Target Start/End: Original strand, 31664390 - 31664541
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    |||||||  |||||||||||  |||||| | |||||||||||||||||| |||||||||| |||||| |||  | || |||||   ||||||||||||||    
31664390 gggcatgctacactacatttcaaaatttattaaatagaatataaaaatccatttattaaacatccaatgaagtcatcatttaaacagcagcggaatatta 31664489  T
499 tcattgaaacgtcaacaa-ctatttaaaactccaaataatatcttggcataa 549  Q
    |   | |||| |||||||    |||||||||||||| |||||||||||||||    
31664490 ttcatcaaacatcaacaatggttttaaaactccaaacaatatcttggcataa 31664541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 10687514 - 10687568
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||  |||||||||||| ||||||||||||||||||||||||    
10687514 gggcatgtcacactactatttcaaatttctcaaatagaatataaaaatctattta 10687568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 10901154 - 10901208
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||  |||||||||||| ||||||||||||||||||||||||    
10901154 gggcatgtcacactactatttcaaatttctcaaatagaatataaaaatctattta 10901208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 402 - 463
Target Start/End: Original strand, 14062382 - 14062444
Alignment:
402 catgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||    
14062382 catgtcacactacattttcaaaatttcttaaatagaatataaaaatctatttaataaacatcc 14062444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 421 - 550
Target Start/End: Complemental strand, 46045599 - 46045470
Alignment:
421 aaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcattgaaacgtcaacaactat 520  Q
    ||||| || ||||||||||||||||||||||||||||| |||||| |||| | ||  ||||   ||||||||||||||||| | |||  ||||| | | |    
46045599 aaattacttaaatagaatataaaaatctatttattaaacatccaatgaaatcatcaattaaatggcagcggaatattatca-tcaaatatcaacgattgt 46045501  T
521 ttaaaa-ctccaaataatatcttggcataaa 550  Q
    | |||| |||||||||| |||||||||||||    
46045500 taaaaacctccaaataacatcttggcataaa 46045470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 55503870 - 55503806
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||    
55503870 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 55503806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 1031755 - 1031803
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||| |||||||||||||||||||||||||    
1031755 gagaaatgatatttgtacaaccactttgtgataacttcttgacaacttt 1031803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 4169941 - 4170000
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
4169941 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 4170000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 362 - 426
Target Start/End: Original strand, 11846478 - 11846542
Alignment:
362 aataaaataagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaaattt 426  Q
    |||||||||| ||| ||||||||||||||  ||| | |||||||||||||| |||||||||||||    
11846478 aataaaataaacacgcatcagagtaataatcccaaacgggcatgtcacacttcattttcaaattt 11846542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 31132481 - 31132422
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
31132481 gggcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 31132422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 33198347 - 33198499
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatta 498  Q
    |||||||  ||||||||| |  |||||||| |||||||||||||||||||||||| |||| ||   | |||| |  | ||||||  ||||||||| ||||    
33198347 gggcatgctacactacatatcaaaatttcttaaatagaatataaaaatctatttagtaaacatttgaagaaatcaacatttaattagcagcggaaaatta 33198446  T
499 tcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||   ||| || |||||| ||| || |||| ||||||||||||||||||||    
33198447 tcatcacaacttctacaactgttttaacctccaaaataatatcttggcataaa 33198499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 445
Target Start/End: Complemental strand, 2585881 - 2585834
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaaa 445  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||||    
2585881 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaaa 2585834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 12931302 - 12931357
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    ||||||||||||||||| ||||||| ||||| |||||||||||||||| |||||||    
12931302 gggcatgtcacactacaatttcaaaatttcttaaatagaatataaaaaactattta 12931357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 14697664 - 14697710
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||    
14697664 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaa 14697710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 38982747 - 38982701
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||    
38982747 gggcatgtcacactacattttcaaaatttcttaaatagaatataaaa 38982701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 401 - 458
Target Start/End: Complemental strand, 41529788 - 41529731
Alignment:
401 gcatgtcacactacattttc-aaatttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||| |||||||| ||||||||||| |||||||||||| ||||    
41529788 gcatgtcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaa 41529731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 520 - 569
Target Start/End: Original strand, 11846638 - 11846687
Alignment:
520 tttaaaactccaaataatatcttggcataaaagcctcaaccagaataatc 569  Q
    |||||||||||| | ||||||| |||||||||||||||||||||| ||||    
11846638 tttaaaactccataaaatatctcggcataaaagcctcaaccagaaaaatc 11846687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 444
Target Start/End: Original strand, 14484972 - 14485016
Alignment:
400 ggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||||||  |||||||| |||||||||||||||    
14484972 ggcatgtcacactacatttcaaaatttcttaaatagaatataaaa 14485016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 402 - 453
Target Start/End: Complemental strand, 37839720 - 37839669
Alignment:
402 catgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    |||||||||||||||||||||| ||||| ||||||||||| ||||||||||||    
37839720 catgtcacactacattttcaaattttctcaaatagaatat-aaaatctattta 37839669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 377 - 464
Target Start/End: Original strand, 40908037 - 40908123
Alignment:
377 catcagagtaataaatccacatgggcatgtcacactaca-ttttcaaatttctgaaatagaatataaaaatctatttattaaatatcca 464  Q
    |||||||||| |||| ||| | ||||||||||||||||| |||| |||||||| |||||||||||  ||||||||||| |||| |||||    
40908037 catcagagtattaaa-ccaaacgggcatgtcacactacatttttaaaatttcttaaatagaatat-gaaatctatttaataaacatcca 40908123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 281 - 329
Target Start/End: Complemental strand, 45548854 - 45548806
Alignment:
281 agaaatgatatacgtacaaccattttgtgataacttcttgacaactttt 329  Q
    |||||||||||  |||||||||||||||||||| || ||||||||||||    
45548854 agaaatgatatttgtacaaccattttgtgataattttttgacaactttt 45548806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 369 - 458
Target Start/End: Original strand, 13451507 - 13451594
Alignment:
369 taagcacacatcagagtaataaatccacatgggcatgtcacactacattttcaa-atttctgaaatagaatataaaaatctatttattaaa 458  Q
    |||||||||||||||||||  |  ||| | ||||||||||||||||||||||||   |||| |||||||||||||||| ||||||| ||||    
13451507 taagcacacatcagagtaa--atcccaaacgggcatgtcacactacattttcaagcattcttaaatagaatataaaaa-ctatttaataaa 13451594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 401 - 463
Target Start/End: Original strand, 16220700 - 16220762
Alignment:
401 gcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatcc 463  Q
    |||| |||||||||||||||||| ||||| ||||||||||| |||||||||||| |||| ||||    
16220700 gcatatcacactacattttcaaaatttcttaaatagaatat-aaaatctatttaataaacatcc 16220762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 399 - 453
Target Start/End: Complemental strand, 42598452 - 42598398
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctattta 453  Q
    |||||| |||||||||||||||||| ||||| ||||||||||| ||||||||||||    
42598452 gggcatatcacactacattttcaaattttcttaaatagaatat-aaaatctattta 42598398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 4896573 - 4896523
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||| ||||||| ||||| |||||||||||    
4896573 aagagaaatgatatttgtacaaccactttgtgacaactttttgacaacttt 4896523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 538 - 568
Target Start/End: Complemental strand, 8056198 - 8056168
Alignment:
538 atcttggcataaaagcctcaaccagaataat 568  Q
    |||||||||||||||||||||||||||||||    
8056198 atcttggcataaaagcctcaaccagaataat 8056168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 280 - 326
Target Start/End: Original strand, 15596396 - 15596442
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaact 326  Q
    ||||||||||||  ||||||||| ||||||| |||||||||||||||    
15596396 gagaaatgatatttgtacaaccactttgtgacaacttcttgacaact 15596442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Original strand, 23094374 - 23094424
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  |||||| |||||||||||||||| | |||||||||    
23094374 aagagaaatgatatttgtacaatcattttgtgataacttttagacaacttt 23094424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 399 - 453
Target Start/End: Original strand, 27904692 - 27904749
Alignment:
399 gggcatgtcacactacattttc-aaatttctgaaatag--aatataaaaatctattta 453  Q
    ||||||||||||||||||| || |||||||| ||||||  ||||||||||||||||||    
27904692 gggcatgtcacactacattatcaaaatttcttaaatagaaaatataaaaatctattta 27904749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 400 - 464
Target Start/End: Original strand, 30395536 - 30395604
Alignment:
400 ggcatgtcacactacatttt--caaatttctgaaatagaatata--aaaatctatttattaaatatcca 464  Q
    ||||||||||||||||||||   |||||||| ||||||||||||  ||||||||||||| ||| |||||    
30395536 ggcatgtcacactacatttttcaaaatttcttaaatagaatataagaaaatctatttatgaaacatcca 30395604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 36444468 - 36444418
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||| ||||||||| || ||||||||    
36444468 aagagaaatgatatttgtacaaccattttatgataactttttaacaacttt 36444418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 44170692 - 44170642
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||||||||| |||| || |||||||||||    
44170692 aagagaaatgatatttgtacaaccattttgttataattttttgacaacttt 44170642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 279 - 329
Target Start/End: Original strand, 47998593 - 47998643
Alignment:
279 agagaaatgatatacgtacaaccattttgtgataacttcttgacaactttt 329  Q
    |||||||||||||  ||||||||||||||| | ||||| ||||||||||||    
47998593 agagaaatgatatttgtacaaccattttgtaacaactttttgacaactttt 47998643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 324
Target Start/End: Original strand, 51318701 - 51318747
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    ||||||||||||||  ||||||||| ||||||||||||| |||||||    
51318701 aagagaaatgatatttgtacaaccactttgtgataactttttgacaa 51318747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 51717355 - 51717305
Alignment:
278 aagagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||||  ||||||||| ||||||| |||||||||| ||||||    
51717355 aagagaaatgatatttgtacaaccaatttgtgacaacttcttgataacttt 51717305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 502
Target Start/End: Complemental strand, 11171928 - 11171855
Alignment:
430 aaatagaatataaaaatctattt-attaaatatccaacgaaaccgtcgtttaatatgcagcggaatattatcat 502  Q
    ||||||||||||||||||||||| |||||| ||||  |||||  ||| || ||| |||||||||||||| ||||    
11171928 aaatagaatataaaaatctatttaattaaacatccttcgaaattgtcattaaatctgcagcggaatattctcat 11171855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 14992352 - 14992307
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
14992352 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 14992307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Complemental strand, 15005699 - 15005654
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
15005699 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 15005654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 16484055 - 16484100
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
16484055 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 16484100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 18260741 - 18260786
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
18260741 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 18260786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 18270704 - 18270749
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
18270704 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 18270749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 30237195 - 30237240
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||  |||||||| |||||||||||||||    
30237195 gggcatgtcacactacttttcaaaatttcttaaatagaatataaaa 30237240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 444
Target Start/End: Original strand, 30873262 - 30873307
Alignment:
399 gggcatgtcacactacattttcaaatttctgaaatagaatataaaa 444  Q
    |||||||||||||||| |||| || ||||| |||||||||||||||    
30873262 gggcatgtcacactactttttaaattttcttaaatagaatataaaa 30873307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 169573 - 169529
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    ||||||||||||  ||||||||||||||||| ||||| |||||||    
169573 gagaaatgatatttgtacaaccattttgtgacaactttttgacaa 169529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 390 - 437
Target Start/End: Complemental strand, 1651781 - 1651733
Alignment:
390 aatccacatgggcatgtcacactacattttcaa-atttctgaaatagaa 437  Q
    |||||||| |||||||||||||| ||||||||| |||||| ||||||||    
1651781 aatccacacgggcatgtcacacttcattttcaagatttcttaaatagaa 1651733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 30042134 - 30042178
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaa 324  Q
    ||||||||||||  ||||||||||||||||| |||||||| ||||    
30042134 gagaaatgatatttgtacaaccattttgtgacaacttcttaacaa 30042178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 31240648 - 31240696
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||| ||||||||||||| || ||||||||    
31240648 gagaaatgatatttgtacaaccactttgtgataacttttttacaacttt 31240696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 39010208 - 39010160
Alignment:
280 gagaaatgatatacgtacaaccattttgtgataacttcttgacaacttt 328  Q
    ||||||||||||  ||||||||||||||||| ||||| |||||| ||||    
39010208 gagaaatgatatttgtacaaccattttgtgacaactttttgacagcttt 39010160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 69; Significance: 1e-30; HSPs: 48)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 399 - 550
Target Start/End: Complemental strand, 24124051 - 24123899
Alignment:
399 gggcatgtcacactacattttcaaattt--ctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||||||||||||||  || |||||||||||||||  ||||||| |||| |||||| |||| | || ||||||  ||||||||||||    
24124051 gggcatgtcacactacattttcaaatttttcttaaatagaatataaaa--ctatttaataaacatccaatgaaatcatcatttaattagcagcggaatat 24123954  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||  |||| ||||||||| |||||| |||| ||||||||||||||||||||    
24123953 tatcatcaaaacatcaacaactgtttaaacctccaaaataatatcttggcataaa 24123899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 399 - 559
Target Start/End: Original strand, 29550307 - 29550467
Alignment:
399 gggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    ||||||||||||||||  | ||||| ||||| ||||||||| ||||||||||||||||||| |||||| |||| | || ||||||  ||||||||||||     
29550307 gggcatgtcacactactatatcaaaatttcttaaatagaatgtaaaaatctatttattaaacatccaatgaaatcatcatttaatcagcagcggaatatc 29550406  T
498 atcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaaagcctcaac 559  Q
    |||| | |||| ||||||||||||||||||||| ||| ||||||||||||| |||||||||||    
29550407 atca-tcaaacatcaacaactatttaaaactccaaaacaatatcttggcat-aaagcctcaac 29550467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 397 - 550
Target Start/End: Original strand, 49162600 - 49162754
Alignment:
397 atgggcatgtcacactacattttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaata 495  Q
    ||||||||||||||||||  | ||||| ||||| ||||||||||||||||||||||||||||| |||||  |||| |  | ||||||  |||||||||||    
49162600 atgggcatgtcacactactatatcaaaatttcttaaatagaatataaaaatctatttattaaacatccatagaaatcaacatttaatcagcagcggaata 49162699  T
496 ttatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    |||||| | |||| ||||||| | ||||||||||| ||||||||||||||||||||    
49162700 ttatca-tcaaacatcaacaattgtttaaaactccaaaataatatcttggcataaa 49162754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 18957210 - 18957364
Alignment:
399 gggcatgtcacactaca-ttttcaaa-tttctgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatat 496  Q
    ||||||||||||||||  |||||||| ||||| ||||||||||||||||||||||||||||| |||||| |||| |  | ||||||  ||||||||||||    
18957210 gggcatgtcacactactcttttcaaaatttcttaaatagaatataaaaatctatttattaaacatccaaagaaatcaacatttaattagcagcggaatat 18957309  T
497 tatcattgaaacgtcaacaactatttaaaactcc-aaataatatcttggcataaa 550  Q
    ||||||  |||| ||||||||| |||  | |||| ||||||||||||||||||||    
18957310 tatcatcaaaacatcaacaactgttttgacctccaaaataatatcttggcataaa 18957364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 329 - 437
Target Start/End: Complemental strand, 41456936 - 41456827
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaa-taaatccaca-tgggcatgtcacactacattttcaaattt 426  Q
    |||||||||||||| ||||||||| ||||||| |||||||||| ||||||||||||||| ||||| || | ||||||||||||||| ||||||||||  |    
41456936 tgtaacaccccattcccaaatataatttattt-aataaaataaacacacatcagagtaattaaattcaaattgggcatgtcacacttcattttcaaaact 41456838  T
427 ctgaaatagaa 437  Q
    || ||||||||    
41456837 cttaaatagaa 41456827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 399 - 550
Target Start/End: Original strand, 12418782 - 12418935
Alignment:
399 gggcatgtcacactacattttcaaatttc-tgaaatagaatataaaaatctatttattaaatatccaacgaaaccgtcgtttaatatgcagcggaatatt 497  Q
    |||||||||||| ||| |||| ||| ||| | ||||||||||||||||||||||||||||| |||||  |||| | || |||| |  |||||||||||||    
12418782 gggcatgtcacaatacttttttaaaattccttaaatagaatataaaaatctatttattaaacatccattgaaatcatcatttatttagcagcggaatatt 12418881  T
498 atcattgaaacgtcaacaactatttaaaactc-caaataatatcttggcataaa 550  Q
    |||||  ||||  |||||||| |||||| |||  |||||| ||| |||||||||    
12418882 atcatcaaaacaacaacaactgtttaaacctcgaaaataaaatcatggcataaa 12418935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 329 - 423
Target Start/End: Original strand, 16490791 - 16490886
Alignment:
329 tgtaacaccccatttccaaatatactttatttaaataaaataagcacacatcagagtaa-taaatccaca-tgggcatgtcacactacattttcaaa 423  Q
    |||||||||||||| ||||||||| ||||||| || || |||| ||||||||||||||| ||||| || | ||||||||||||||||||||||||||    
16490791 tgtaacaccccattcccaaatataatttattt-aacaagataaacacacatcagagtaattaaattcaaattgggcatgtcacactacattttcaaa 16490886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 373 - 455
Target Start/End: Complemental strand, 18757773 - 18757694
Alignment:
373 cacacatcagagtaataaatccacatgggcatgtcacactacattttcaaatttctgaaatagaatataaaaatctatttatt 455  Q
    |||||||||||||||  || ||| | ||||||||||||||||||||||||| |||| |||||||||||||||| |||||||||    
18757773 cacacatcagagtaa--aacccaaacgggcatgtcacactacattttcaaaattcttaaatagaatataaaaa-ctatttatt 18757694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 399 - 555
Target Start/End: Original strand, 14292167 - 14292330
Alignment:
399 gggcatgtcacactacattttcaaa--tttctgaaatagaatataaaaatctattt-attaaatatccaacgaaaccgtcgtttaatatgcagcggaata 495  Q
    |||||||||||||||||||||||||  ||||| ||||||||||||||||||||||| |||||| ||||  | |||   || || ||| ||||||||||||    
14292167 gggcatgtcacactacattttcaaaattttcttaaatagaatataaaaatctatttaattaaacatcctccaaaattatcattaaatctgcagcggaata 14292266  T
496 ttatcattgaaacgtcaac---aactatttaaaactcca-aataatatcttggcataaaagcct 555  Q
    || ||||  ||||  ||||   |||| |||||| ||||| |||||  |||||||||||||||||    
14292267 ttctcatcaaaacaacaacaataactgtttaaacctccataataaattcttggcataaaagcct 14292330  T

Back To: [ HSP Overview ] [