View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_20 (Length: 437)

Name: NF0095_high_20
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_20
NF0095_high_20
[»] chr4 (1 HSPs)
chr4 (1-376)||(50741948-50742322)


Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 50741948 - 50742322
Alignment:
1 aagttggtttactccacagtgacttgagtttaannnnnnnatgttacaatatcttcagccttgatttgttacaaattcattgattctgattgattgtatt 100  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50741948 aagttggtttactccacagtgacttgagtttaagggggggatgttacaatatcttcagccttgatttgttacaaattcattgattctgattgattgtatt 50742047  T
101 aggaggataccatttatttgtaactaccatatcttgtatggctagaatcttctgtaaagtcttgacatacaaagaaatatacagaaatgcaatgcaatcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50742048 aggaggataccatttatttgtaactaccatatcttgtatggctagaatcttctgtaaagtcttgacatacaaagaaatatacagaaatgcaatgcaatcc 50742147  T
201 ttgacaacaatattagcttacaatgaaaacccgccgtccctttcacttcaaaatccaatgttgactgcaaatgacattnnnnnnnnnnnngcaagtgaga 300  Q
    ||||||||||||||||||||||||||||||| |    |||||||||||||||||||||||||||||||||||||||||            ||||||||||    
50742148 ttgacaacaatattagcttacaatgaaaacctg----ccctttcacttcaaaatccaatgttgactgcaaatgacattaaaaaacaaaaagcaagtgaga 50742243  T
301 gcttacgggtgtggaacattatgccaagcagttacattaggaatgtg---ttcttcttcttctccttcctgtccatcta 376  Q
    |||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||    
50742244 gcttacgggtgtggaacattatgccaagcagttacattaggaatgtgttcttcttcttcttctccttcctgtccatcta 50742322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150902 times since January 2019
Visitors: 1524