View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_23 (Length: 374)

Name: NF0095_high_23
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_23
NF0095_high_23
[»] chr5 (1 HSPs)
chr5 (1-317)||(6625795-6626111)


Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 6626111 - 6625795
Alignment:
1 tgtttatgttgccactaataggtatgtgtaccaaagttaggcaaccagtttgagctattcacttttctctttctcatctggcatccctgaaacatatttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
6626111 tgtttatgttgccactaataggtatgtgtaccaaagttaggcaaccagtttgagctattcacttttctctttctcatctggcatctctgaaacatatttt 6626012  T
101 cattccttgcagagaaactggagcattgtgtgcaatgaaggaagcagacatattttttgatgatccaaaatctgccgagagtataaagcagttagaacag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6626011 cattccttgcagagaaactggagcattgtgtgcaatgaaggaagcagacatattttttgatgatccaaaatctgccgagagtataaagcagttagaacag 6625912  T
201 gttttcatccatcacttggttgttaatgctgtttatttattatctgtatggtgtatgaagtatgtacatttaaattcactatctgttttatttgttctgt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6625911 gttttcatccatcacttggttgttaatgctgtttatttattatatgtatggtgtatgaagtatgtacatttaaattcactatctgttttatttgttctgt 6625812  T
301 ctgttggtgtggacact 317  Q
    |||||||||||||||||    
6625811 ctgttggtgtggacact 6625795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125293 times since January 2019
Visitors: 1390