View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_24 (Length: 370)

Name: NF0095_high_24
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_24
NF0095_high_24
[»] chr5 (1 HSPs)
chr5 (43-370)||(19755198-19755525)
[»] chr3 (1 HSPs)
chr3 (81-181)||(8135128-8135228)


Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 43 - 370
Target Start/End: Original strand, 19755198 - 19755525
Alignment:
43 catcatcagagttcaacccacgaggttctttactttttccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttc 142  Q
    |||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||    
19755198 catcttcagagttcaacccacgaggttctttactttttccactttcgaccagagatggacccccttcattttcttcatcaatgtgttgttgatcatcttc 19755297  T
143 aacacttttagcattcaaatcttgaggaggttcagaaagcattttctctcggtcttcatcatctttgggaggactagagtcaactatcatattgtcctca 242  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||    
19755298 aacacttttatcattcaaatcttgaggaggttcagaaagcattttctctgggtcttcatcatctttgggaggactagagtcaattatcatattgtcctca 19755397  T
243 aagatggggtcaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaactttagcacccttaaacacataaaaaagtc 342  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||    
19755398 aagatggggttaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaacttcagcaccctgaaacacattaaaaagtc 19755497  T
343 gaagtaaataaagaaggcttgttaaaga 370  Q
    ||||| ||||||||||| ||||||||||    
19755498 gaagttaataaagaaggtttgttaaaga 19755525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 81 - 181
Target Start/End: Complemental strand, 8135228 - 8135128
Alignment:
81 ccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaa 180  Q
    |||| ||||||  |||||||||||||||| | ||| |||| | |||| || ||||||||||||| |||| | |||||  ||||||||| | | |||||||    
8135228 ccactttcgactagagatggacccccttcgtcttcctcatcagtgtgatgctgatcatcttcaatacttctggcatttgaatcttgagaatgatcagaaa 8135129  T
181 g 181  Q
    |    
8135128 g 8135128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126223 times since January 2019
Visitors: 1390