View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_26 (Length: 370)

Name: NF0095_high_26
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_26
[»] scaffold0234 (2 HSPs)
scaffold0234 (23-344)||(2041-2362)
scaffold0234 (23-344)||(10932-11253)
[»] chr6 (43 HSPs)
chr6 (23-344)||(17684189-17684510)
chr6 (23-344)||(27380972-27381293)
chr6 (23-344)||(27471355-27471676)
chr6 (23-344)||(11651889-11652210)
chr6 (23-344)||(17691160-17691481)
chr6 (23-344)||(29309056-29309377)
chr6 (23-344)||(29316016-29316336)
chr6 (23-344)||(188697-189018)
chr6 (105-344)||(27296877-27297116)
chr6 (71-344)||(16394165-16394438)
chr6 (103-340)||(25536915-25537152)
chr6 (122-343)||(16559193-16559414)
chr6 (19-327)||(13359010-13359314)
chr6 (23-127)||(16566257-16566361)
chr6 (40-334)||(2669476-2669768)
chr6 (37-344)||(16789071-16789373)
chr6 (37-344)||(22859888-22860190)
chr6 (37-344)||(27508347-27508649)
chr6 (37-344)||(1586108-1586410)
chr6 (37-330)||(27527947-27528235)
chr6 (37-344)||(14074480-14074782)
chr6 (37-300)||(18019885-18020143)
chr6 (29-322)||(10359073-10359359)
chr6 (37-344)||(8612915-8613221)
chr6 (38-166)||(27925935-27926062)
chr6 (38-241)||(17850321-17850521)
chr6 (107-259)||(20736413-20736562)
chr6 (55-160)||(28172754-28172859)
chr6 (29-161)||(20553492-20553622)
chr6 (90-275)||(8510155-8510338)
chr6 (231-344)||(33317055-33317167)
chr6 (105-344)||(17120505-17120740)
chr6 (23-75)||(25537148-25537200)
chr6 (37-132)||(13995151-13995245)
chr6 (105-247)||(21994655-21994794)
chr6 (35-247)||(19218427-19218630)
chr6 (51-172)||(19347092-19347212)
chr6 (36-216)||(22560311-22560487)
chr6 (203-266)||(28172899-28172963)
chr6 (188-327)||(28756145-28756283)
chr6 (112-259)||(5758565-5758709)
chr6 (35-247)||(4073574-4073781)
chr6 (37-73)||(20736594-20736630)
[»] chr4 (57 HSPs)
chr4 (23-344)||(18262378-18262699)
chr4 (23-344)||(18269239-18269560)
chr4 (23-344)||(55612849-55613170)
chr4 (23-344)||(26963806-26964127)
chr4 (23-344)||(26970629-26970950)
chr4 (23-344)||(868763-869084)
chr4 (23-344)||(19926480-19926801)
chr4 (23-344)||(5707486-5707807)
chr4 (23-344)||(5714114-5714435)
chr4 (23-344)||(8858333-8858654)
chr4 (23-344)||(10621053-10621374)
chr4 (29-344)||(10628132-10628447)
chr4 (23-344)||(28392854-28393175)
chr4 (23-344)||(8845369-8845690)
chr4 (23-344)||(4426336-4426645)
chr4 (29-344)||(35223732-35224047)
chr4 (33-344)||(5667849-5668156)
chr4 (23-348)||(20311458-20311781)
chr4 (112-344)||(10677303-10677534)
chr4 (112-344)||(10890943-10891174)
chr4 (37-344)||(15461497-15461799)
chr4 (37-344)||(34975551-34975853)
chr4 (37-344)||(2677013-2677315)
chr4 (37-344)||(15815021-15815323)
chr4 (37-344)||(18111043-18111345)
chr4 (37-344)||(3369023-3369325)
chr4 (37-344)||(17299959-17300261)
chr4 (37-344)||(18163162-18163464)
chr4 (37-344)||(20243937-20244239)
chr4 (37-344)||(26531613-26531915)
chr4 (37-344)||(4675983-4676285)
chr4 (33-169)||(56516232-56516368)
chr4 (38-344)||(5870419-5870720)
chr4 (93-243)||(21453961-21454110)
chr4 (37-328)||(19365519-19365806)
chr4 (37-344)||(1941724-1942026)
chr4 (58-344)||(32646523-32646807)
chr4 (105-327)||(19362477-19362695)
chr4 (112-344)||(9487625-9487853)
chr4 (37-242)||(32636484-32636685)
chr4 (105-328)||(5528495-5528714)
chr4 (29-328)||(5616387-5616681)
chr4 (41-119)||(24700213-24700291)
chr4 (124-344)||(30040489-30040705)
chr4 (112-328)||(9538033-9538244)
chr4 (37-259)||(4546080-4546298)
chr4 (127-344)||(11421096-11421309)
chr4 (216-266)||(24701361-24701411)
chr4 (93-247)||(33888594-33888743)
chr4 (29-81)||(10677538-10677590)
chr4 (29-81)||(10891178-10891230)
chr4 (84-211)||(34777850-34777975)
chr4 (25-95)||(9937933-9938003)
chr4 (235-316)||(9937745-9937826)
chr4 (114-205)||(9937830-9937923)
chr4 (37-73)||(11421016-11421052)
chr4 (29-73)||(30040740-30040784)
[»] chr3 (46 HSPs)
chr3 (23-344)||(6110230-6110551)
chr3 (23-344)||(16482203-16482524)
chr3 (23-344)||(10579075-10579396)
chr3 (23-344)||(15600604-15600925)
chr3 (23-344)||(15607149-15607470)
chr3 (23-344)||(10572312-10572633)
chr3 (23-344)||(15341939-15342260)
chr3 (23-344)||(18520141-18520462)
chr3 (38-344)||(8490676-8490982)
chr3 (30-340)||(18522836-18523146)
chr3 (23-344)||(15357306-15357627)
chr3 (23-344)||(17780838-17781159)
chr3 (23-344)||(13211468-13211789)
chr3 (29-344)||(13248779-13249094)
chr3 (23-344)||(32056619-32056941)
chr3 (23-348)||(17199900-17200225)
chr3 (23-344)||(13516977-13517294)
chr3 (29-344)||(1647241-1647556)
chr3 (23-344)||(17136525-17136840)
chr3 (23-344)||(29925137-29925458)
chr3 (23-344)||(29974290-29974611)
chr3 (54-344)||(16200627-16200917)
chr3 (37-344)||(21034238-21034540)
chr3 (37-344)||(15846536-15846838)
chr3 (37-344)||(20147554-20147856)
chr3 (37-344)||(21398792-21399094)
chr3 (29-326)||(24253130-24253423)
chr3 (37-344)||(14890391-14890693)
chr3 (37-344)||(55427021-55427323)
chr3 (37-344)||(12299911-12300212)
chr3 (105-344)||(25978728-25978963)
chr3 (29-246)||(14147013-14147226)
chr3 (112-310)||(15526827-15527021)
chr3 (186-344)||(28088251-28088408)
chr3 (105-344)||(11787654-11787889)
chr3 (40-344)||(15317176-15317472)
chr3 (76-205)||(28953965-28954093)
chr3 (23-75)||(19089734-19089786)
chr3 (78-270)||(32280313-32280507)
chr3 (29-122)||(9504455-9504548)
chr3 (33-148)||(8251933-8252048)
chr3 (191-306)||(30464147-30464261)
chr3 (23-96)||(16200291-16200363)
chr3 (183-247)||(36138033-36138097)
chr3 (116-168)||(4189223-4189275)
chr3 (183-247)||(36142816-36142880)
[»] chr1 (38 HSPs)
chr1 (23-344)||(18252196-18252517)
chr1 (23-344)||(18532234-18532555)
chr1 (23-344)||(27131130-27131450)
chr1 (23-344)||(27310297-27310618)
chr1 (23-344)||(16358755-16359076)
chr1 (29-344)||(3855639-3855954)
chr1 (29-344)||(36816354-36816668)
chr1 (63-344)||(22641594-22641871)
chr1 (29-344)||(27277278-27277592)
chr1 (23-216)||(21171081-21171274)
chr1 (37-344)||(19706439-19706741)
chr1 (37-344)||(43802365-43802667)
chr1 (37-344)||(28134723-28135025)
chr1 (23-177)||(22657108-22657262)
chr1 (53-344)||(23507096-23507385)
chr1 (37-344)||(9456116-9456418)
chr1 (151-344)||(9916497-9916689)
chr1 (29-266)||(12014084-12014319)
chr1 (37-344)||(20391239-20391541)
chr1 (37-344)||(20779645-20779947)
chr1 (37-344)||(22670257-22670559)
chr1 (37-344)||(42816989-42817291)
chr1 (37-344)||(22612492-22612794)
chr1 (28-324)||(633925-634216)
chr1 (30-146)||(9917837-9917952)
chr1 (37-344)||(8727667-8727969)
chr1 (37-344)||(47667485-47667776)
chr1 (105-328)||(29096789-29097008)
chr1 (37-169)||(35930582-35930713)
chr1 (53-142)||(12006461-12006550)
chr1 (231-344)||(28145723-28145835)
chr1 (112-244)||(21881475-21881604)
chr1 (92-257)||(24301691-24301855)
chr1 (45-171)||(26923553-26923678)
chr1 (112-165)||(51997353-51997406)
chr1 (197-277)||(12006332-12006413)
chr1 (183-242)||(10852402-10852461)
chr1 (126-205)||(31236402-31236478)
[»] chr8 (42 HSPs)
chr8 (23-343)||(21940831-21941151)
chr8 (23-344)||(22171653-22171974)
chr8 (23-344)||(6094289-6094610)
chr8 (23-344)||(24642815-24643135)
chr8 (81-344)||(15326422-15326685)
chr8 (81-344)||(15506791-15507054)
chr8 (203-344)||(28548393-28548534)
chr8 (34-277)||(14983710-14983950)
chr8 (29-344)||(8371253-8371563)
chr8 (37-344)||(21969333-21969635)
chr8 (32-229)||(24797224-24797419)
chr8 (37-344)||(12562123-12562425)
chr8 (37-344)||(27007517-27007819)
chr8 (37-344)||(27014660-27014962)
chr8 (37-344)||(27880487-27880789)
chr8 (37-344)||(28020668-28020970)
chr8 (29-328)||(38232115-38232412)
chr8 (37-344)||(22130609-22130911)
chr8 (37-344)||(25611195-25611497)
chr8 (38-344)||(22659494-22659795)
chr8 (37-344)||(21916676-21916978)
chr8 (37-344)||(45534273-45534575)
chr8 (37-344)||(26240484-26240786)
chr8 (29-247)||(18835342-18835556)
chr8 (25-164)||(32872741-32872880)
chr8 (105-344)||(6430953-6431188)
chr8 (113-259)||(8781959-8782102)
chr8 (60-146)||(2375214-2375300)
chr8 (237-334)||(24796731-24796826)
chr8 (182-328)||(20535226-20535371)
chr8 (105-344)||(2962932-2963171)
chr8 (40-134)||(29645537-29645631)
chr8 (231-349)||(36970439-36970556)
chr8 (231-348)||(2375411-2375528)
chr8 (37-144)||(36970265-36970371)
chr8 (195-317)||(29645675-29645797)
chr8 (84-136)||(10920427-10920479)
chr8 (56-111)||(24535514-24535569)
chr8 (23-58)||(28555049-28555084)
chr8 (283-344)||(8968015-8968076)
chr8 (284-332)||(41368106-41368154)
chr8 (284-332)||(41375077-41375125)
[»] chr5 (35 HSPs)
chr5 (29-344)||(24695186-24695501)
chr5 (23-344)||(19714218-19714539)
chr5 (23-344)||(19706939-19707259)
chr5 (23-344)||(18569581-18569904)
chr5 (23-222)||(39538754-39538953)
chr5 (53-344)||(17298621-17298912)
chr5 (53-344)||(17285470-17285759)
chr5 (29-257)||(18806843-18807069)
chr5 (182-348)||(27347252-27347417)
chr5 (237-344)||(24701950-24702057)
chr5 (37-344)||(20941027-20941329)
chr5 (37-344)||(25805385-25805687)
chr5 (37-344)||(31899-32201)
chr5 (37-344)||(12789663-12789965)
chr5 (37-344)||(22941250-22941552)
chr5 (37-344)||(23545922-23546224)
chr5 (34-168)||(22546912-22547046)
chr5 (37-344)||(24933306-24933608)
chr5 (39-332)||(20100255-20100543)
chr5 (37-344)||(31096816-31097118)
chr5 (37-344)||(12764990-12765296)
chr5 (37-344)||(5097651-5097953)
chr5 (37-344)||(7865430-7865736)
chr5 (37-344)||(9811733-9812039)
chr5 (37-344)||(12703874-12704180)
chr5 (119-257)||(18806483-18806619)
chr5 (119-257)||(18806663-18806799)
chr5 (29-117)||(27347425-27347513)
chr5 (259-348)||(28719471-28719558)
chr5 (95-344)||(18829281-18829530)
chr5 (37-344)||(26245102-26245404)
chr5 (105-348)||(26129689-26129928)
chr5 (263-344)||(39538954-39539035)
chr5 (40-169)||(33477193-33477321)
chr5 (38-82)||(39535465-39535509)
[»] scaffold0433 (1 HSPs)
scaffold0433 (23-344)||(7273-7594)
[»] scaffold0390 (2 HSPs)
scaffold0390 (23-344)||(6654-6975)
scaffold0390 (23-344)||(13670-13991)
[»] chr7 (49 HSPs)
chr7 (23-340)||(15152609-15152926)
chr7 (23-344)||(29327950-29328271)
chr7 (23-344)||(11535782-11536103)
chr7 (23-344)||(11542700-11543021)
chr7 (18-344)||(12750987-12751313)
chr7 (23-344)||(12738702-12739023)
chr7 (23-344)||(18561173-18561485)
chr7 (33-344)||(13392326-13392637)
chr7 (32-350)||(18257559-18257874)
chr7 (37-344)||(2204552-2204854)
chr7 (37-344)||(8464999-8465301)
chr7 (37-344)||(18400104-18400406)
chr7 (37-344)||(18407088-18407390)
chr7 (37-344)||(48808496-48808798)
chr7 (37-344)||(15729751-15730053)
chr7 (37-344)||(18139338-18139640)
chr7 (37-344)||(19230888-19231190)
chr7 (37-332)||(30254138-30254428)
chr7 (104-344)||(2365169-2365407)
chr7 (105-344)||(41680968-41681203)
chr7 (37-344)||(10668901-10669204)
chr7 (37-332)||(47166871-47167161)
chr7 (38-322)||(24443349-24443628)
chr7 (112-344)||(34128647-34128875)
chr7 (29-259)||(19388544-19388774)
chr7 (37-344)||(28130561-28130863)
chr7 (56-146)||(10235361-10235451)
chr7 (35-322)||(25845498-25845780)
chr7 (35-322)||(25845917-25846199)
chr7 (37-306)||(19393462-19393726)
chr7 (105-344)||(18259124-18259359)
chr7 (38-146)||(47833875-47833983)
chr7 (23-78)||(15148308-15148363)
chr7 (28-137)||(19859113-19859221)
chr7 (196-333)||(39112138-39112275)
chr7 (32-170)||(3132849-3132986)
chr7 (42-160)||(7662569-7662686)
chr7 (112-344)||(14591924-14592153)
chr7 (112-344)||(16011515-16011744)
chr7 (119-258)||(31190524-31190660)
chr7 (29-115)||(7396361-7396450)
chr7 (112-244)||(22969024-22969153)
chr7 (195-270)||(22948499-22948574)
chr7 (156-344)||(15169290-15169474)
chr7 (102-160)||(7396469-7396527)
chr7 (71-126)||(29983179-29983234)
chr7 (34-137)||(39111989-39112092)
chr7 (33-75)||(2365070-2365112)
chr7 (190-254)||(29984308-29984372)
[»] scaffold0220 (1 HSPs)
scaffold0220 (23-344)||(18454-18774)
[»] scaffold0186 (1 HSPs)
scaffold0186 (23-348)||(25706-26031)
[»] chr2 (28 HSPs)
chr2 (23-344)||(21329968-21330289)
chr2 (23-344)||(18796672-18796993)
chr2 (29-350)||(18619976-18620296)
chr2 (29-344)||(36270338-36270650)
chr2 (29-344)||(22183206-22183518)
chr2 (73-344)||(20978091-20978360)
chr2 (32-330)||(6991847-6992146)
chr2 (23-332)||(18822249-18822556)
chr2 (37-344)||(30174377-30174679)
chr2 (37-344)||(24250032-24250334)
chr2 (37-344)||(24229215-24229517)
chr2 (29-169)||(19279460-19279600)
chr2 (38-146)||(18851977-18852085)
chr2 (105-332)||(15342014-15342237)
chr2 (38-346)||(29800468-29800775)
chr2 (181-344)||(17241034-17241196)
chr2 (43-146)||(36801899-36802003)
chr2 (37-259)||(19616435-19616653)
chr2 (197-277)||(36799745-36799826)
chr2 (112-246)||(40301034-40301164)
chr2 (39-146)||(28741220-28741326)
chr2 (277-344)||(41661694-41661761)
chr2 (114-319)||(41316305-41316506)
chr2 (112-247)||(21626824-21626955)
chr2 (183-259)||(28740910-28740986)
chr2 (108-171)||(28718943-28719006)
chr2 (29-146)||(24763751-24763867)
chr2 (33-73)||(12098609-12098649)
[»] scaffold0657 (1 HSPs)
scaffold0657 (23-325)||(1159-1461)
[»] scaffold0063 (1 HSPs)
scaffold0063 (23-348)||(5695-6013)
[»] scaffold0008 (1 HSPs)
scaffold0008 (88-344)||(230111-230367)
[»] scaffold0112 (1 HSPs)
scaffold0112 (37-344)||(183-485)
[»] scaffold0264 (1 HSPs)
scaffold0264 (37-344)||(3675-3977)
[»] scaffold0028 (1 HSPs)
scaffold0028 (37-344)||(119730-120032)
[»] scaffold0466 (1 HSPs)
scaffold0466 (37-332)||(12961-13251)
[»] scaffold0001 (1 HSPs)
scaffold0001 (37-306)||(130262-130526)
[»] scaffold0006 (1 HSPs)
scaffold0006 (37-344)||(67374-67676)
[»] scaffold0031 (1 HSPs)
scaffold0031 (37-344)||(39988-40290)
[»] scaffold0378 (1 HSPs)
scaffold0378 (37-247)||(8305-8511)
[»] scaffold0111 (1 HSPs)
scaffold0111 (105-344)||(26609-26844)
[»] scaffold0039 (1 HSPs)
scaffold0039 (29-146)||(90033-90151)
[»] scaffold0136 (1 HSPs)
scaffold0136 (29-316)||(8723-9005)
[»] scaffold0297 (1 HSPs)
scaffold0297 (154-344)||(102-288)
[»] scaffold0376 (1 HSPs)
scaffold0376 (112-344)||(11526-11758)
[»] scaffold0034 (1 HSPs)
scaffold0034 (112-247)||(83111-83243)
[»] scaffold0086 (1 HSPs)
scaffold0086 (38-344)||(53766-54066)
[»] scaffold0118 (1 HSPs)
scaffold0118 (76-167)||(45956-46051)
[»] scaffold0393 (1 HSPs)
scaffold0393 (29-73)||(15089-15133)

Alignment Details
Target: scaffold0234 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: scaffold0234

Target: scaffold0234; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 2362 - 2041
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2362 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 2263  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
2262 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 2163  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
2162 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 2063  T
323 gatgggtactccatgaatcatg 344  Q
2062 gatgggtactccatgaatcatg 2041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0234; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 11253 - 10932
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11253 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 11154  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
11153 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 11054  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
11053 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 10954  T
323 gatgggtactccatgaatcatg 344  Q
10953 gatgggtactccatgaatcatg 10932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 310; Significance: 1e-174; HSPs: 43)
Name: chr6

Target: chr6; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 17684510 - 17684189
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17684510 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 17684411  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17684410 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17684311  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
17684310 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 17684211  T
323 gatgggtactccatgaatcatg 344  Q
17684210 gatgggtactccatgaatcatg 17684189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27381293 - 27380972
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27381293 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 27381194  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
27381193 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 27381094  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
27381093 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 27380994  T
323 gatgggtactccatgaatcatg 344  Q
27380993 gatgggtactccatgaatcatg 27380972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27471676 - 27471355
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27471676 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 27471577  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
27471576 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 27471477  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
27471476 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 27471377  T
323 gatgggtactccatgaatcatg 344  Q
27471376 gatgggtactccatgaatcatg 27471355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 11651889 - 11652210
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11651889 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 11651988  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
11651989 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcataatgatagtggtgtattc 11652088  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
11652089 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 11652188  T
323 gatgggtactccatgaatcatg 344  Q
11652189 gatgggtactccatgaatcatg 11652210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 17691481 - 17691160
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
17691481 atcattaaagcataaagactattatgtaggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 17691382  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17691381 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17691282  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
17691281 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 17691182  T
323 gatgggtactccatgaatcatg 344  Q
17691181 gatgggtactccatgaatcatg 17691160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29309056 - 29309377
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29309056 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 29309155  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29309156 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29309255  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29309256 cacccttcgacctgaaaccactatgtaccctagatgttggagtcaggtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 29309355  T
323 gatgggtactccatgaatcatg 344  Q
29309356 gatgggtactccatgaatcatg 29309377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29316016 - 29316336
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29316016 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 29316115  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29316116 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29316215  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29316216 cacccttcgacctgaaaccactatgtaccctagatgttggagtc-agtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 29316314  T
323 gatgggtactccatgaatcatg 344  Q
29316315 gatgggtactccatgaatcatg 29316336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 189018 - 188697
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
189018 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 188919  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
188918 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 188819  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||  ||||| ||||||| ||||||||||||||| ||    
188818 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgttatcattcaaatattgtctgtaacagaatgactataaagttgatt 188719  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| |||||||| |||||||    
188718 gatggatactccataaatcatg 188697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 105 - 344
Target Start/End: Original strand, 27296877 - 27297116
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||    
27296877 acattgatataaatattaggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcat 27296976  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
27296977 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 27297076  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
27297077 atgactataaagttggttgatgggtactccatgaatcatg 27297116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 71 - 344
Target Start/End: Complemental strand, 16394438 - 16394165
71 tcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagt 170  Q
    ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||| ||||    
16394438 tcacatatcatggataaacagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgacccaccatgagaatactacgtagt 16394339  T
171 aaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagt 270  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||    
16394338 aaaagttatgaaaagtgtcataagatattcttatagtgatagtggtgtattccaccctttgacttgaaaccactatgtaccctagatgttggaatcgagt 16394239  T
271 gctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||    
16394238 gctttgtcaccattcaaacgttgtctgtaacaagatgactataaagttggttgatgggtactccatgaatcatg 16394165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 103 - 340
Target Start/End: Complemental strand, 25537152 - 25536915
103 tcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctc 202  Q
    |||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
25537152 tcacatagatataaatattaggtgtcatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctc 25537053  T
203 atagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaaca 302  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25537052 atagtgacagtggtgtattccacccttcgacctgaaaccactatttaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaaca 25536953  T
303 ggatgactataaagttggttgatgggtactccatgaat 340  Q
    |||||| |||||||||||||||||||||||||||||||    
25536952 ggatgattataaagttggttgatgggtactccatgaat 25536915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 122 - 343
Target Start/End: Complemental strand, 16559414 - 16559193
122 aggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtatt 221  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
16559414 aggagtaatatttatattggattgatccaccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtatt 16559315  T
222 ccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 321  Q
    |||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
16559314 ccacccttcgacctgaaaccgctatgtaccgtagatgttggagtcgagtgttttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 16559215  T
322 tgatgggtactccatgaatcat 343  Q
16559214 tgatgggtactccatgaatcat 16559193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 19 - 327
Target Start/End: Complemental strand, 13359314 - 13359010
19 ggacatcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaat 118  Q
    ||||| ||| ||||| ||||||||||||| | | |||||||||||||||||||| || |||||||||||| ||||||||| ||||||| ||||||||| |    
13359314 ggacaacattaaagcgtagagactattatatggatagactgatgatcacatctcgcaaatcatggataaaaagttatcaaatcttcacttagatataagt 13359215  T
119 attaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata-gtggtg 217  Q
    ||||| |||| ||||||||||| ||||   |  |||||  ||||||||| | |||  ||||  ||| ||||||||  |||||||||||||||| ||||||    
13359214 attagaagtagtatttatattgaattgtctcaccatga--atactacattgaaaa--ttatgtaaa-tgtcataaattattctcatagtgataagtggtg 13359120  T
218 tattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagt 317  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||||||||  |||||  || | ||||| | |||||||||||||||||||||||||    
13359119 tattccacccttcgacctgaaaccactatgtaccttagatgtaggagtcgagtattttgttgccgtacaaacatcgtccgtaacaggatgactataaagt 13359020  T
318 tggttgatgg 327  Q
13359019 cggttgatgg 13359010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 23 - 127
Target Start/End: Complemental strand, 16566361 - 16566257
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16566361 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 16566262  T
123 ggagt 127  Q
16566261 ggagt 16566257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 40 - 334
Target Start/End: Original strand, 2669476 - 2669768
40 actattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatatt 139  Q
    |||||||| | |||||| ||||||||||||||||   ||||| ||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||    
2669476 actattatatgggtagattgatgatcacatctcatgaatcattgattaagagttatcatgtattcacatagatataaatattaggagtaatatttatatt 2669575  T
140 ggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtga-tagtggtgtattccacccttcgacctgaa 238  Q
     ||||||  | |||||| ||||||||||||  || ||| |   |||| ||||||| ||||||||||||||  ||| |||||||||||  || ||||||||    
2669576 tgattgacacatcatgaaaatactacatag--aatgttgt-ttaagtatcataagttattctcatagtgacaagttgtgtattccactatttgacctgaa 2669672  T
239 accactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactcc 334  Q
    | || ||||||| |||||||| ||||||  || ||||||   | |||||| ||| ||  ||||||||||||||||||||  |||||| ||||||||    
2669673 atcattatgtactctagatgtaggagtccggtactttgttgtcgttcaaatgttatctataacaggatgactataaagtcagttgattggtactcc 2669768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 16789071 - 16789373
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
16789071 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 16789169  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
16789170 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 16789266  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||   ||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
16789267 aaaccactatgatctctagatg-tggactcaagtgctttgttgtcattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 16789365  T
337 gaatcatg 344  Q
16789366 gaatcatg 16789373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 22860190 - 22859888
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
22860190 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 22860092  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
22860091 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 22859995  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || |||| |||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
22859994 aaaccactatgatctctagatg-tggactcaagtgttttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 22859896  T
337 gaatcatg 344  Q
22859895 gaatcatg 22859888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 27508649 - 27508347
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||| ||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||| |    
27508649 gagactgttatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttgt 27508551  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  ||||||| |||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
27508550 attggattgacccactgtgagaatactacatagt--aagttatgaaaa-tgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 27508454  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
27508453 aaaccactatgatctctagatg-tggattcaagtgctttgttgccattctaacgttgtctgtaaaaggataaaaataacgttggttgatgggtacttgat 27508355  T
337 gaatcatg 344  Q
27508354 gaatcatg 27508347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 1586410 - 1586108
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
1586410 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 1586312  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
1586311 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 1586215  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
1586214 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 1586116  T
337 gaatcatg 344  Q
1586115 gaatcatg 1586108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 37 - 330
Target Start/End: Complemental strand, 27528235 - 27527947
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||| ||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||| |    
27528235 gagactgttatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttgt 27528137  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  ||||||| |||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
27528136 attggattgacccactgtgagaatactacatagt--aagttatgaaaa-tgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 27528040  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggta 330  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||    
27528039 aaaccactatgatctctagatg-tggattcaagtgctttgttgccattctaacgttgtctgtaaaaggataaaaataacgttggttgatgggta 27527947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 14074480 - 14074782
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  |||||| |||||||||| ||||||||||||||    
14074480 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacataggtataaatattgggagtaatatttat 14074578  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    | |||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||| ||| | |||||   ||||||    | ||| ||||||    
14074579 aatggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattttcacaatgataaaagtgtatattgctcttagacctg 14074675  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| | || || ||||||||||  || ||| ||| ||||| |||| ||||| || |||| |||||||||||||||||  ||    
14074676 aaaccactatgatccctagatg-tagactcaagtgctttgttgcctttctaacattgtctgtaaaaggataaccataacgttggttgatgggtacttgat 14074774  T
337 gaatcatg 344  Q
14074775 gaatcatg 14074782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 37 - 300
Target Start/End: Complemental strand, 18020143 - 18019885
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
18020143 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 18020045  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
18020044 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 18019948  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaa 300  Q
    ||| |||||||  | ||||||| | || || ||| ||||||  |||||| ||||||||| ||||    
18019947 aaatcactatgatctctagatg-tcgactcaagtactttgttgccattctaacgttgtctgtaa 18019885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 29 - 322
Target Start/End: Complemental strand, 10359359 - 10359073
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||| ||||||||||||| || ||||| |||||| |||||||||  | ||||| ||   ||| ||| ||||||  ||||||||||||||||||   |||    
10359359 aaagcgtagagactattatatatgtagagtgatgaccacatctcatgg-tcatgaatgt-gagatattaagtctatacatagatataaatattataggta 10359262  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| ||||| || ||  | ||| ||||||||||||||   ||||| ||  ||||||||||||||||||| | ||||| |||||||| |||| ||    
10359261 atatttatactggatcgacccaccgtgaaaatactacatagtat--gttatgaa--gtgtcataagatattctcacaatgataatggtgtataccactct 10359166  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    | ||| |||||||||||||  ||||||||| |||| ||| ||||||| |   ||||||||| |||||||||||||||| || || |||||||||    
10359165 tagacttgaaaccactatgatccctagatg-tggactcgtgtgctttattgtcattcaaacattgtccgtaacaggataaccattaagttggtt 10359073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 8612915 - 8613221
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||    
8612915 gagactattatgtatgtagactgatgaccgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttat 8613013  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaa---agtgtcataagatattctcatagtgatagtggtgtattccacccttcgac 233  Q
    | ||||| || ||  | ||||||||||||||||||   ||||| | |   | |||||||||||||||||| | ||||| | ||||||  | | ||| |||    
8613014 actggatagacccaccgtgagaatactacatagtac--gttatgagattaattgtcataagatattctcacaatgataatagtgtatatcgctcttagac 8613111  T
234 ctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactc 333  Q
    ||||||||||||||  ||||||||| |||| || |||  |||||  || ||| ||||||||| |||| ||||| || ||||  ||||||||||||||||     
8613112 ctgaaaccactatgatccctagatg-tggactcaagtattttgtttcccttctaacgttgtctgtaaaaggataaccataacattggttgatgggtactt 8613210  T
334 catgaatcatg 344  Q
8613211 gatgaatcatg 8613221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 38 - 166
Target Start/End: Original strand, 27925935 - 27926062
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    |||||||||||| | || |||||||||| |||||||| ||||||||||||||| |||| |||| ||||||||||||| || ||||||| |||||||||||    
27925935 agactattatgtggataaactgatgatctcatctcacggatcatggataaagatttatgaagttttcacatagatattaa-attaggaataatatttata 27926033  T
138 ttggattgatccgtcatgagaatactaca 166  Q
    ||| |||||  || ||||| |||||||||    
27926034 ttgaattgactcgccatgataatactaca 27926062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 38 - 241
Target Start/End: Complemental strand, 17850521 - 17850321
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    |||||||||| | |||||||||||||||| |||| | ||||||| || || ||||||||  || ||||||||| ||||||||||| ||||||||| ||||    
17850521 agactattatatgggtagactgatgatcatatcttatagatcattgacaacgagttatcgtgtattcacataggtataaatattatgagtaatatatata 17850422  T
138 ttggattgatccgtcatgagaatactacatagtaaaagttata-aaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    ||||||||| ||  | | |||||||||||| |     ||| ||   |||| ||||||| |||||| |||||||||||| ||||| |||||||| ||||||    
17850421 ttggattgaccctccttaagaatactacattg----ggttttatgtaagtatcataagttattcttatagtgatagtgatgtataccaccctttgacctg 17850326  T
237 aaacc 241  Q
17850325 aaacc 17850321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 107 - 259
Target Start/End: Complemental strand, 20736562 - 20736413
107 atagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatag 206  Q
    |||| |||||||||||||||||||||||||| ||||||||||| || ||||||||||||||| |  | | ||| |||| |||||||||||||||||| ||    
20736562 ataggtataaatattaggagtaatatttatactggattgatccatcgtgagaatactacatatt--atgctatgaaaa-tgtcataagatattctcacag 20736466  T
207 tgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgt 259  Q
    ||||| | ||||||  ||| ||| ||||| |||| ||||||  ||||||||||    
20736465 tgataatagtgtatatcactcttagacctaaaactactatgatccctagatgt 20736413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 55 - 160
Target Start/End: Original strand, 28172754 - 28172859
55 gactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcat 154  Q
    ||||||||||||||||| ||||||||| | |||| |||||||||||||| |||||||||||||||||| | ||| | ||||||||||||||| ||  |||    
28172754 gactgatgatcacatcttacagatcattgttaaaaagttatcaagtctttacatagatataaatattaagggtagtgtttatattggattgaccctccat 28172853  T
155 gagaat 160  Q
28172854 gagaat 28172859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 29 - 161
Target Start/End: Complemental strand, 20553622 - 20553492
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||||| ||| | |||||| ||||||||||||||||||||||||| ||||| ||||||||  ||||||   ||||||||||||| ||||||| || ||    
20553622 aaagcataaagatttttatgttggtagactgatgatcacatctcacatatcatcgataaagaaatatcaaacattcacatagatat-aatattaagaata 20553524  T
129 atatttatattggattgatccgtcatgagaata 161  Q
    ||||||||||| |||||| || |||||||||||    
20553523 atatttatatt-gattgacccatcatgagaata 20553492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 90 - 275
Target Start/End: Original strand, 8510155 - 8510338
90 agttatcaagtcttcacatagatataaa-tattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgt 188  Q
    ||||||||  |||||| ||||||| ||| |||||| ||||||||||||||| |||||| |    |||| ||||||||||||  || |||||  || ||||    
8510155 agttatcatttcttcatatagataaaaaatattagaagtaatatttatatttgattgacctacaatgataatactacatag--aatgttatgtaa-gtgt 8510251  T
189 cataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgcttt 275  Q
    ||| || || |||||||||||| |||||| ||| ||  ||||| |||| |||||||||||||| ||||||| |||||||||| ||||    
8510252 cattagttactctcatagtgatggtggtgcattacatgcttcggcctggaaccactatgtaccttagatgtaggagtcgagtacttt 8510338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 344
Target Start/End: Original strand, 33317055 - 33317167
231 gacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggta 330  Q
    |||||||||||||||||  |||||||||| ||| || ||| ||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||    
33317055 gacctgaaaccactatgatccctagatgt-ggactcaagtactttgtttccattctaacgttgtctgtaaaaggataaccataacgttggttgatgggta 33317153  T
331 ctccatgaatcatg 344  Q
    ||  ||||||||||    
33317154 cttgatgaatcatg 33317167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 105 - 344
Target Start/End: Complemental strand, 17120740 - 17120505
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||||| |||||||| |||||||| |||||||| ||    ||||||| ||| ||||||   ||||| |||  ||||||||||||||||||     
17120740 acataggtataaatactaggagtagtatttatactggattgacccactgtgagaatgctaaatagtat--gttatgaaat-tgtcataagatattctcac 17120644  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| |  |||||  | | ||| |||||||||||||||||  ||||| |||| ||| || ||||||||||   ||||| ||||||||| || | |||    
17120643 aatgataataatgtatatcgctcttagacctgaaaccactatgatccctatatgt-ggactcaagtgctttgttgtcattctaacgttgtctgtcaaagg 17120545  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    || || |||| |||||||||||||| ||  ||||||||||    
17120544 ataaccataacgttggttgatgggtgcttgatgaatcatg 17120505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 25537200 - 25537148
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcaca 75  Q
    ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
25537200 atcattaaagcataaagactattatgtaggtagactgatgatcacatctcaca 25537148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 37 - 132
Target Start/End: Complemental strand, 13995245 - 13995151
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||    
13995245 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatat 13995151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 105 - 247
Target Start/End: Original strand, 21994655 - 21994794
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||| |||| |||||||||||||| |||| ||| ||  ||||||||||||| |||||  | ||||| |||| |||||||||||||| |||     
21994655 acatagctataaacattacgagtaatatttatactggaatgacccaccatgagaatactaaatagt--atgttatgaaaa-tgtcataagatattttcac 21994751  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    | ||||| ||||||||  ||| ||| |||||||||| ||||||    
21994752 aatgataatggtgtatatcactcttagacctgaaacgactatg 21994794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 35 - 247
Target Start/End: Original strand, 19218427 - 19218630
35 tagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattt 134  Q
    |||||||||||||||| |||||||||||| |||| ||||  | ||||| || | ||| ||| ||||||  |||||  |||||||||||||||||| ||||    
19218427 tagagactattatgtatgtagactgatgaccacacctcatgggtcatgaat-atgagatattaagtctatacatatgtataaatattaggagtaaaattt 19218525  T
135 atattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacc 234  Q
    ||     ||||| ||  | |||||||||||||||||  | ||||| |||| | |||||||||||||||| | ||||| || | ||| | || ||| ||||    
19218526 at-----attgacccaccgtgagaatactacatagt--atgttatgaaaa-tttcataagatattctcagaatgataatgatatatactactcttagacc 19218617  T
235 tgaaaccactatg 247  Q
19218618 tgaaaccactatg 19218630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 51 - 172
Target Start/End: Complemental strand, 19347212 - 19347092
51 ggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccg 150  Q
    |||||| |||||| || |||||||| ||||| ||||||||||| ||| || ||||||||  |||||| |||| || |||||||| || |||||||| | |    
19347212 ggtagattgatgaccatatctcacatatcattgataaagagttgtcatgttttcacataagtataaacatta-gaataatatttgtaatggattgaactg 19347114  T
151 tcatgagaatactacatagtaa 172  Q
     ||| |||||||||||||||||    
19347113 ccattagaatactacatagtaa 19347092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 36 - 216
Target Start/End: Complemental strand, 22560487 - 22560311
36 agagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattta 135  Q
    ||||||||||||| | |||||| ||||| |||||||||  | |||||||||  ||| ||| |||| |  |||||| | ||||||||||||||||||||||    
22560487 agagactattatgcatgtagaccgatgaccacatctcatgggtcatggatat-gagatattaagtttatacataggtttaaatattaggagtaatattta 22560389  T
136 tattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggt 216  Q
    || || ||||| |    ||||||| ||||||||||  | ||||| |||| |||||||||||||||||| | ||||| ||||    
22560388 tactgtattgacctactatgagaacactacatagt--atgttatgaaaa-tgtcataagatattctcacaatgataatggt 22560311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 203 - 266
Target Start/End: Original strand, 28172899 - 28172963
203 atagtgata-gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtc 266  Q
    ||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| | ||||||    
28172899 atagtgataagtggtgtattccacccttcgaccggaaaccagtatgtaccctagatataggagtc 28172963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 327
Target Start/End: Complemental strand, 28756283 - 28756145
188 tcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaa 287  Q
    |||||| ||||||||||||||||| || | |||  || |||  |||||||||||||| |||||| || |||| ||||||  || |||| |||||| ||||    
28756283 tcataaaatattctcatagtgataatgatttatctcatcctatgacctgaaaccactgtgtaccatatatgtaggagtcatgtactttatcacca-tcaa 28756185  T
288 acgttgtccgtaacaggatgactataaagttggttgatgg 327  Q
    | |||||  |||||| |||| ||||||||| |||||||||    
28756184 atgttgtatgtaacaagatgcctataaagtcggttgatgg 28756145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 112 - 259
Target Start/End: Complemental strand, 5758709 - 5758565
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| ||||| |||||    |||||||||||||||||  | |||||  | | || ||||||||||||||| | | |||    
5758709 tataaatattaggagtaatatttatactggatagatccactgtgagaatactacatagt--acgttat-gagattgccataagatattctcacaattata 5758613  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgt 259  Q
     | ||||||  | | ||| |||||||||||||||||  ||||||||||    
5758612 atagtgtatatcgctcttagacctgaaaccactatgatccctagatgt 5758565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 35 - 247
Target Start/End: Original strand, 4073574 - 4073781
35 tagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattt 134  Q
    |||||||||||||||  ||||| ||| ||||||||| || || ||||| |||  ||| ||| ||||||  |||||  | ||||||||||  |||||||||    
4073574 tagagactattatgtttgtagattgaggatcacatcccataggtcatgaatat-gagatattaagtctatacataagtgtaaatattagaggtaatattt 4073672  T
135 atattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacc 234  Q
    ||||| |||||| |   | |||||||||||||||  | | ||||| ||||   |||||||||||||||||| |||||  | ||||| |||  ||| ||||    
4073673 atatttgattgacctaccgtgagaatactacata--atatgttatgaaaa--ttcataagatattctcataatgataacgatgtataccaatcttagacc 4073768  T
235 tgaaaccactatg 247  Q
    | |||||||||||    
4073769 taaaaccactatg 4073781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 37 - 73
Target Start/End: Complemental strand, 20736630 - 20736594
37 gagactattatgtaggtagactgatgatcacatctca 73  Q
    |||||||||||||| |||||||||||| |||||||||    
20736630 gagactattatgtatgtagactgatgaccacatctca 20736594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 57)
Name: chr4

Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18262378 - 18262699
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18262378 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18262477  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18262478 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18262577  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
18262578 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18262677  T
323 gatgggtactccatgaatcatg 344  Q
18262678 gatgggtactccatgaatcatg 18262699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18269239 - 18269560
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18269239 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18269338  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18269339 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18269438  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
18269439 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18269538  T
323 gatgggtactccatgaatcatg 344  Q
18269539 gatgggtactccatgaatcatg 18269560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 55612849 - 55613170
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55612849 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 55612948  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
55612949 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 55613048  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
55613049 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 55613148  T
323 gatgggtactccatgaatcatg 344  Q
55613149 gatgggtactccatgaatcatg 55613170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 26963806 - 26964127
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26963806 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 26963905  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
26963906 gcagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 26964005  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
26964006 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 26964105  T
323 gatgggtactccatgaatcatg 344  Q
26964106 gatgggtactccatgaatcatg 26964127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 26970629 - 26970950
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26970629 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 26970728  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
26970729 gcagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 26970828  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
26970829 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 26970928  T
323 gatgggtactccatgaatcatg 344  Q
26970929 gatgggtactccatgaatcatg 26970950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 868763 - 869084
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
868763 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaaaagttatcaagtcttcacatagatataaatatta 868862  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||    
868863 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgataatggtgtattc 868962  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
868963 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 869062  T
323 gatgggtactccatgaatcatg 344  Q
869063 gatgggtactccatgaatcatg 869084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 19926801 - 19926480
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
19926801 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcaaatagatataaatatta 19926702  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||    
19926701 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaaatgtcataagatattctcatagtgatagtggtgtattc 19926602  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
19926601 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 19926502  T
323 gatgggtactccatgaatcatg 344  Q
19926501 gatgggtactccatgaatcatg 19926480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 5707486 - 5707807
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5707486 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 5707585  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
5707586 tgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 5707685  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
5707686 catccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggtt 5707785  T
323 gatgggtactccatgaatcatg 344  Q
5707786 gatgggtactccatgaatcatg 5707807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 5714114 - 5714435
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5714114 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 5714213  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
5714214 tgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 5714313  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
5714314 catccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggtt 5714413  T
323 gatgggtactccatgaatcatg 344  Q
5714414 gatgggtactccatgaatcatg 5714435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 8858333 - 8858654
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
8858333 atcattaaagcatagagactattatgtgggtaggctgatgatcacatctcacagatcatggataaagagttatcaagtcttcatatagatataaatatta 8858432  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
8858433 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 8858532  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
8858533 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 8858632  T
323 gatgggtactccatgaatcatg 344  Q
8858633 gatgggtactccatgaatcatg 8858654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 10621374 - 10621053
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
10621374 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatttta 10621275  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||    
10621274 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgttttc 10621175  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
10621174 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggtt 10621075  T
323 gatgggtactccatgaatcatg 344  Q
10621074 gatgggtactccatgaatcatg 10621053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 10628447 - 10628132
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
10628447 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 10628348  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||    
10628347 atatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgataatggtgttttccaccct 10628248  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
10628247 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggttgatggg 10628148  T
329 tactccatgaatcatg 344  Q
10628147 tactccatgaatcatg 10628132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 28393175 - 28392854
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
28393175 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 28393076  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28393075 gaagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 28392976  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28392975 cacccttcaacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 28392876  T
323 gatgggtactccatgaatcatg 344  Q
    |||| |||||||||||||||||    
28392875 gatgagtactccatgaatcatg 28392854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 8845369 - 8845690
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||    
8845369 atcattaaagcatagagactattatgtgggtaggctgatgatcacatctcacagatcatggataaagagttatcaattctttatatagatataaatatta 8845468  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
8845469 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataatatattctcatagtgatagtggtgtattc 8845568  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
8845569 catccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaatttggtt 8845668  T
323 gatgggtactccatgaatcatg 344  Q
8845669 gatgggtactccatgaatcatg 8845690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 4426645 - 4426336
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4426645 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 4426546  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||  ||| |||||            |||||||||||||||||||||||||    
4426545 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaatctatgaaaag------------ttctcatagtgatagtggtgtattc 4426458  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||    
4426457 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgttaccattcaaacattgtccgtaataggatgactataaagttggtt 4426358  T
323 gatgggtactccatgaatcatg 344  Q
4426357 gatgggtactccatgaatcatg 4426336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 29 - 344
Target Start/End: Original strand, 35223732 - 35224047
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||||| |||||||||||| ||||||| |||||||||||||||| |||||| ||||||||||||||| ||||| |||||  |||||||||||||||||    
35223732 aaagcatatagactattatgtgggtagacggatgatcacatctcacggatcatagataaagagttatcatgtctttacatatgtataaatattaggagta 35223831  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| |||||||| ||  ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||    
35223832 atatttatactggattgaaccaccatgagaatactatatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtgttgtattccaccct 35223931  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | ||||||||||||| ||||||| ||||||||||||||||||||||| ||| ||||||||||||||| |||||| ||||||||||||||||||||||| |    
35223932 ttgacctgaaaccacgatgtaccttagatgttggagtcgagtgctttatcaacattcaaacgttgtctgtaacaagatgactataaagttggttgatgtg 35224031  T
329 tactccatgaatcatg 344  Q
    ||||||| ||||||||    
35224032 tactccacgaatcatg 35224047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 33 - 344
Target Start/End: Complemental strand, 5668156 - 5667849
33 catagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    ||||||||||||||||| | ||||| ||||||||  |||||| |||||| |||||||||||||||  ||||||| ||| |||||||||||||||||||||    
5668156 catagagactattatgtggatagaccgatgatca--tctcacggatcatagataaagagttatcatatcttcacgtaggtataaatattaggagtaatat 5668059  T
133 ttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcga 232  Q
    ||||| ||||||||  |  |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5668058 ttatactggattgactcaccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttaga 5667959  T
233 cctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtact 332  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||    
5667958 cctgaaaccactatgtaccctagatgttg--gtcgagtgctttgtcaccattcaaacgttgtctgtaacaagatgactataaagttggttgatgggtact 5667861  T
333 ccatgaatcatg 344  Q
    ||| ||||||||    
5667860 ccacgaatcatg 5667849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 23 - 348
Target Start/End: Original strand, 20311458 - 20311781
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||| ||| |||||| |||||||||||| |||  ||||||||||||||||||||||||||||||||||||| |||||||||    
20311458 atcattaaagcatagagactattttgtgggtagattgatgatcacatatcatggatcatggataaagagttatcaagtcttcacatagatgtaaatatta 20311557  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtatt 221  Q
    |||||||| ||||||||||||||| | ||||||||||||||||||||  | ||||||   || | |||||   ||||||||||||||| |||||||||||    
20311558 ggagtaatttttatattggattgacctgtcatgagaatactacatag--acagttat-gtaactatcatacattattctcatagtgataagtggtgtatt 20311654  T
222 ccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 321  Q
    ||||||||| || |||||||||||| |||||||||||| ||| |||||| ||||||  || | ||||||||||||||| ||||||||||||||||| |||    
20311655 ccacccttctacttgaaaccactatttaccctagatgtaggattcgagtactttgttcccgtacaaacgttgtccgtagcaggatgactataaagtcggt 20311754  T
322 tgatgggtactccatgaatcatgatga 348  Q
    | || ||||||||| ||||||||||||    
20311755 taatcggtactccacgaatcatgatga 20311781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 112 - 344
Target Start/End: Complemental strand, 10677534 - 10677303
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| |||||||| ||   ||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||    
10677534 tataaatattaggagtaatatttatactggattgacccactatgagaatactacatagtaaatgttatgaaaaatgtcataagatattctcatagtgata 10677435  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
    |||||||||| ||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||  ||||||| |||||||||  |||| | |||||| |    
10677434 gtggtgtatttcaccctttgacttgaaaccactatgtatcctagatgtaggagtcgagtgctttaccaccatttaaacgttgtttgtaataagatgac-a 10677336  T
312 taaagttggttgatgggtactccatgaatcatg 344  Q
    |||||||||| ||||||||||||||||| ||||    
10677335 taaagttggtagatgggtactccatgaaccatg 10677303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 112 - 344
Target Start/End: Complemental strand, 10891174 - 10890943
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| |||||||| ||   ||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||    
10891174 tataaatattaggagtaatatttatactggattgacccactatgagaatactacatagtaaatgttatgaaaaatgtcataagatattctcatagtgata 10891075  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
    |||||||||| ||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||  ||||||| |||||||||  |||| | |||||| |    
10891074 gtggtgtatttcaccctttgacttgaaaccactatgtatcctagatgtaggagtcgagtgctttaccaccatttaaacgttgtttgtaataagatgac-a 10890976  T
312 taaagttggttgatgggtactccatgaatcatg 344  Q
    |||||||||| ||||||||||||||||| ||||    
10890975 taaagttggtagatgggtactccatgaaccatg 10890943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 15461497 - 15461799
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
15461497 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 15461595  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
15461596 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 15461692  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
15461693 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 15461791  T
337 gaatcatg 344  Q
15461792 gaatcatg 15461799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 34975551 - 34975853
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
34975551 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 34975649  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
34975650 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 34975746  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
34975747 aaaccactatgatccctagatg-tggactcaagtgctttgtttccattctaacgttgtctgtaaaaggataaccataacgttggttgatgggtacttgat 34975845  T
337 gaatcatg 344  Q
34975846 gaatcatg 34975853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 2677013 - 2677315
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
2677013 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 2677111  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
2677112 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 2677208  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
2677209 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 2677307  T
337 gaatcatg 344  Q
2677308 gaatcatg 2677315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 15815021 - 15815323
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
15815021 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 15815119  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
15815120 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 15815216  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
15815217 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 15815315  T
337 gaatcatg 344  Q
15815316 gaatcatg 15815323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 18111345 - 18111043
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
18111345 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 18111247  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
18111246 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 18111150  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
18111149 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 18111051  T
337 gaatcatg 344  Q
18111050 gaatcatg 18111043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 3369325 - 3369023
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||| |    
3369325 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttgt 3369227  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
3369226 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 3369130  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | || |||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
3369129 aaaccactatgatctcttgatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 3369031  T
337 gaatcatg 344  Q
3369030 gaatcatg 3369023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 17300261 - 17299959
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
17300261 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 17300163  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
17300162 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 17300066  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||| | |||  ||    
17300065 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgagcacttgat 17299967  T
337 gaatcatg 344  Q
17299966 gaatcatg 17299959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 18163162 - 18163464
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||||| |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
18163162 gagactattatgtatgtagactgatgatcgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 18163260  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||| | ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
18163261 attggattcacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 18163357  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
18163358 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 18163456  T
337 gaatcatg 344  Q
18163457 gaatcatg 18163464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 20243937 - 20244239
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
20243937 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 20244035  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
20244036 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 20244132  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
20244133 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 20244231  T
337 gaatcatg 344  Q
20244232 gaatcatg 20244239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 26531613 - 26531915
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||| ||  ||||| ||||||||||||||||||||||||||    
26531613 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaaggctatacataaatataaatattaggagtaatatttat 26531711  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
26531712 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 26531808  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
26531809 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 26531907  T
337 gaatcatg 344  Q
26531908 gaatcatg 26531915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 4676285 - 4675983
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
4676285 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 4676187  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
4676186 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 4676090  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||  ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
4676089 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattataacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 4675991  T
337 gaatcatg 344  Q
4675990 gaatcatg 4675983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 33 - 169
Target Start/End: Original strand, 56516232 - 56516368
33 catagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    |||||||||||||||||||||||| | ||||||| ||||||||||| ||||||||||||||||||||||||||||||  ||||||||| | |||||||||    
56516232 catagagactattatgtaggtagattaatgatcaaatctcacagataatggataaagagttatcaagtcttcacatacgtataaatatcatgagtaatat 56516331  T
133 ttatattggattgatccgtcatgagaatactacatag 169  Q
    ||||||||||||||  ||  ||||||| |||||||||    
56516332 ttatattggattgactcgctatgagaacactacatag 56516368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 38 - 344
Target Start/End: Original strand, 5870419 - 5870720
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    ||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||||||    
5870419 agactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttata 5870517  T
138 ttggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctga 237  Q
    ||||||||| ||    |||||||||||||||||  |||||||  ||| ||||||| |||||||||| | ||||| |  |||||  | | ||| |||||||    
5870518 ttggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcatatgatattctcacaatgataataatgtatatcgctcttagacctga 5870614  T
238 aaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatg 337  Q
    ||||||||||  | ||||||| |||| || |||| |||||   ||||| |||||||||  ||| ||||| || |||| ||||||||||| |||||  |||    
5870615 aaccactatgatctctagatg-tggactcaagtgttttgttgtcattctaacgttgtctataataggataacaataacgttggttgatgagtacttgatg 5870713  T
338 aatcatg 344  Q
5870714 aatcatg 5870720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 93 - 243
Target Start/End: Complemental strand, 21454110 - 21453961
93 tatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcata 192  Q
    |||||||| |||||||| |||||||||||||||||||||||||||||| ||||| ||  ||||||||||||||||| ||  ||||||  ||| | |||||    
21454110 tatcaagttttcacatacatataaatattaggagtaatatttatattgaattgacccaccatgagaatactacata-tatgagttatgtaaaatatcata 21454012  T
193 agatattctcatagtgatagtggtgtattccacccttcgacctgaaaccac 243  Q
    ||||||| |||| |||||||||||||||  |||||||||||||||||||||    
21454011 agatattttcattgtgatagtggtgtatgtcacccttcgacctgaaaccac 21453961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 37 - 328
Target Start/End: Original strand, 19365519 - 19365806
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    ||||||||||| || |||||||||||| |||||||||  | |||||  ||  ||| ||| || |||  |||||| |||||||||||||||||||||||||    
19365519 gagactattatatacgtagactgatgaccacatctcatgggtcatgagtat-gagatattaaatctatacataggtataaatattaggagtaatatttat 19365617  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctca-tagtgatagtggtgtattccacccttcgacct 235  Q
    | |||||||| ||  | ||||| |||||||||||  | |||||  ||||||||||||||||||||||  | ||||| |||||||| |||| ||| |||||    
19365618 actggattgacccaccgtgagagtactacatagt--atgttat-gaaagtgtcataagatattctcaccaatgataatggtgtataccactcttagacct 19365714  T
236 gaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||| ||||  ||||||||| |||| || |||||||| |   ||||||||||||||| ||||||||||||| |||| ||| ||| |||||    
19365715 gaaaccattatgatccctagatg-tggactcaagtgctttattgtcattcaaacgttgtctgtaacaggatgaccataacgttagttaatggg 19365806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 1941724 - 1942026
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    ||||||||||||||  ||||||||||| | |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||    
1941724 gagactattatgtatatagactgatgaccgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttat 1941822  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||| | ||  | |||||||||||||||||||  ||||| | |  |||||| ||||||||||| | ||||| | ||||||  | | ||| ||||||    
1941823 attggattaacccaccgtgagaatactacatagtaa--gttatgagat-tgtcatgagatattctcacaatgataatagtgtatatcgctcttagacctg 1941919  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  |||||||||| ||| || ||| ||||||  |||||| || |||||| |||| ||||| || |||| |||||||||||||||||  ||    
1941920 aaaccactatgatccctagatgt-ggactcaagtactttgttgccattctaatgttgtctgtaaaaggataaccataacgttggttgatgggtacttgat 1942018  T
337 gaatcatg 344  Q
1942019 gaatcatg 1942026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 58 - 344
Target Start/End: Complemental strand, 32646807 - 32646523
58 tgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgag 157  Q
    ||||||||||||||||| |||||| |||||||   |||| |||||||||||||||||||||||||||| ||||||||| |||||||||| |   ||| ||    
32646807 tgatgatcacatctcacggatcattgataaaggaatatcgagtcttcacatagatataaatattaggaataatatttacattggattgacctaccataag 32646708  T
158 aatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtattccacccttcgacctgaaaccactatgtaccctaga 256  Q
    ||| |||||||  ||| |||||  | |  |||| | || |||| | ||||||| |||||||||||  ||||||||||||||||| ||| |||| ||| ||    
32646707 aatgctacata--aaaggttatgtata-agtcacatgacattcccgtagtgataagtggtgtattttacccttcgacctgaaacaactctgtatcctgga 32646611  T
257 tgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    |||  |||||| || ||||||   | | |||||||  ||| ||||||||||| ||| |||| |||||||||||||   ||||||||||    
32646610 tgtatgagtcgggtactttgttgtcgtacaaacgtcatccataacaggatgattatgaagtcggttgatgggtaccggatgaatcatg 32646523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 105 - 327
Target Start/End: Original strand, 19362477 - 19362695
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| ||| |||||||||||||||||||||| |||||||| || || ||||| |||||||||||  | |||||  ||||||||||||||||||||||     
19362477 acataggtattaatattaggagtaatatttatactggattgacccatcgtgagagtactacatagt--atgttat-caaagtgtcataagatattctcac 19362573  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| |||||||| |||| |||  ||||||||||||||||  || |||||| |||| |  | |||||| |   ||||||||||||||| ||||||||    
19362574 aatgataatggtgtataccactcttaaacctgaaaccactatgatccttagatg-tggacttaaatgctttattgtcattcaaacgttgtctgtaacagg 19362672  T
305 atgactataaagttggttgatgg 327  Q
    ||||| |||| | ||||| ||||    
19362673 atgaccataacggtggttaatgg 19362695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 112 - 344
Target Start/End: Original strand, 9487625 - 9487853
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| ||||| || || || |||||||||||||||||  |||||||  | | |||||||||||||||||| | |||||    
9487625 tataaatattaggagtaatatttatactggatagacccatcgtgagaatactacatagt--aagttat-gagattgtcataagatattctcacaatgata 9487721  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
     | ||||||  | | ||| |||||||||||||||||  ||||||||| |||| || |||  |||||   ||||  ||||||||| |||| ||||| || |    
9487722 atagtgtatatcgctcttagacctgaaaccactatgatccctagatg-tggactcaagtattttgttgtcattataacgttgtctgtaataggataacca 9487820  T
312 taaagttggttgatgggtactccatgaatcatg 344  Q
    |||  ||||||||||||||||  ||||||||||    
9487821 taacattggttgatgggtacttgatgaatcatg 9487853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 37 - 242
Target Start/End: Original strand, 32636484 - 32636685
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | ||||| |||  ||| ||| |||||    ||||| ||||||||||| |||||||||||||    
32636484 gagactattatgtatgtagactgatgaccgcatctcatgggtcatgaatac-gagatattaagtccatgcataggtataaatattatgagtaatatttat 32636582  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |||||||| |||| || |||| ||    
32636583 attggattgacccaatgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataatggtgtataccactctccgacgtg 32636679  T
237 aaacca 242  Q
32636680 aaacca 32636685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 105 - 328
Target Start/End: Complemental strand, 5528714 - 5528495
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||||||||||||| |||||||||||| ||| | ||  | ||||||||| || ||||| |  |||| |||| || ||||||||||||||||    
5528714 acataggtataaatattaggagtgatatttatattgtattaacccaacgtgagaataccacgtagtata--ttatgaaaa-tgccataagatattctcat 5528618  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| ||||||||  ||| |||  |||||||||  |||||  ||||||||| |||| || |||||||| |  ||||||||||||| || ||||||||    
5528617 aatgataatggtgtataacactcttatacctgaaactgctatgatccctagatg-tggactcaagtgctttatttccattcaaacgttatctgtaacagg 5528519  T
305 atgactataaagttggttgatggg 328  Q
    || || |||| ||||||| |||||    
5528518 ataaccataatgttggttaatggg 5528495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 29 - 328
Target Start/End: Original strand, 5616387 - 5616681
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||| |||||||||||||| ||||| |||||| |||||||||  | ||||  |||  ||| | | |||| |  || ||| |||||||||||| ||||    
5616387 aaagcattgagactattatgtatgtagattgatgaccacatctcatgggtcataaatat-gagatgttaagtatatacgtaggtataaatattagaagta 5616485  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| |||||||| |   | ||||||||||||| |||  |  |||| ||| ||||||||||||||||| | | ||||| |||||||| |||  ||    
5616486 atatttatactggattgaccaaccgtgagaatactacagagttta--ttatgaaa-gtgtcataagatattcttacaatgataatggtgtataccaatct 5616582  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | || ||||||||||||||  ||||||||| |||| || |||||||| |  |||||||||||||||  |||||| ||| ||| ||| ||||||| |||||    
5616583 tagatctgaaaccactatgatccctagatg-tggactcaagtgctttattgccattcaaacgttgtttgtaacaagataactgtaacgttggttaatggg 5616681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 41 - 119
Target Start/End: Original strand, 24700213 - 24700291
41 ctattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaata 119  Q
    ||||||||| ||||||||||| ||||||||| ||||||| ||||||||||| ||| |||||||||||||||||||||||    
24700213 ctattatgtgggtagactgataatcacatcttacagatcttggataaagagatattaagtcttcacatagatataaata 24700291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 124 - 344
Target Start/End: Complemental strand, 30040705 - 30040489
124 gagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattcc 223  Q
    |||||||||||||| | |||||| ||  ||||||| ||||||||||||   ||||| |||| |||||||||||||||||| | ||||| | ||||||  |    
30040705 gagtaatatttatactagattgacccaccatgagagtactacatagtat--gttatgaaaa-tgtcataagatattctcacaatgataatagtgtatatc 30040609  T
224 acccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttg 323  Q
    || ||| |||||||||||||||||  ||||||||| |||| || ||||||||||   ||||| || |||||  |||| ||||| || |||| |||||||     
30040608 actcttagacctgaaaccactatgatccctagatg-tggactcaagtgctttgttgtcattctaatgttgtttgtaaaaggataaccataacgttggtta 30040510  T
324 atgggtactccatgaatcatg 344  Q
    ||| |||||  ||||||||||    
30040509 atgagtacttgatgaatcatg 30040489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 112 - 328
Target Start/End: Original strand, 9538033 - 9538244
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    ||||||| |||||||||||||||||| |||||||| ||  | ||||||||||||||||   | |||||  |||||||||||||||||||||| | |||||    
9538033 tataaatgttaggagtaatatttatactggattgacccagcgtgagaatactacatag--catgttat-gaaagtgtcataagatattctcacaatgata 9538129  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
     ||| ||  ||||  ||| ||||| ||||||| |||  || | |||| |||| || |||||||| |  |||||||||| |||||||||||||||| || |    
9538130 atggcgt-gtccagtcttagacctcaaaccaccatgatccttggatg-tggactcaagtgctttattgccattcaaacattgtccgtaacaggataacca 9538227  T
312 taaagttggttgatggg 328  Q
    ||| ||||||| |||||    
9538228 taacgttggttaatggg 9538244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 259
Target Start/End: Original strand, 4546080 - 4546298
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| || ||||||| ||| |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||    
4546080 gagactattatgtatgttgactgataatcgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttat 4546178  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    | ||||  || ||  | |||||||||||||||||  |||||||  | | |||||||||||||||||| | ||||| | ||||||  | | ||| |||||     
4546179 actggacagacccaccgtgagaatactacatagt--aagttat-gagattgtcataagatattctcacaatgataatagtgtatatcgctctttgaccta 4546275  T
237 aaaccactatgtaccctagatgt 259  Q
    |||||||||||  ||||||||||    
4546276 aaaccactatgatccctagatgt 4546298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 344
Target Start/End: Original strand, 11421096 - 11421309
127 taatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacc 226  Q
    |||||||||||||||||||| ||  | | |||||||||||||||  | ||||| |||| |||||||||||||| ||| || |||| |  |||||  |||     
11421096 taatatttatattggattgacccaccgttagaatactacatagt--atgttatgaaaa-tgtcataagatattatcacagggataataatgtatatcact 11421192  T
227 cttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatg 326  Q
    | | |||||||||||||||||  || |||||| || | || |||||||| |   ||||| ||||||||| |||| ||||| || |||| ||||| | |||    
11421193 catagacctgaaaccactatgatccgtagatg-tgtactcaagtgctttattgtcattctaacgttgtctgtaaaaggataaccataatgttggctaatg 11421291  T
327 ggtactccatgaatcatg 344  Q
    ||||||| ||||||||||    
11421292 ggtactcgatgaatcatg 11421309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 216 - 266
Target Start/End: Original strand, 24701361 - 24701411
216 tgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtc 266  Q
    |||||||||||||||||||| |||||||| |||||||||||||| ||||||    
24701361 tgtattccacccttcgacctaaaaccactgtgtaccctagatgtaggagtc 24701411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 93 - 247
Target Start/End: Original strand, 33888594 - 33888743
93 tatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcata 192  Q
    |||||||| ||||||||||||||||||||| | ||||||||||   || ||||| ||  ||||| ||||| |||||  |  | ||||  ||||||| |||    
33888594 tatcaagttttcacatagatataaatattatgtgtaatattta---tgaattgacccaccatgataataccacata--atgatttatgtaaagtgtgata 33888688  T
193 agatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    ||||| | ||||| ||| |||||||||| ||||  |||||||||||| |||||||    
33888689 agataatatcatattgacagtggtgtatgccacatttcgacctgaaatcactatg 33888743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 10677590 - 10677538
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcat 81  Q
    |||| ||| |||||||||||| |||||||||||||||||||||||| ||||||    
10677590 aaagtatatagactattatgtgggtagactgatgatcacatctcacggatcat 10677538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 10891230 - 10891178
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcat 81  Q
    |||| ||| |||||||||||| |||||||||||||||||||||||| ||||||    
10891230 aaagtatatagactattatgtgggtagactgatgatcacatctcacggatcat 10891178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 84 - 211
Target Start/End: Complemental strand, 34777975 - 34777850
84 ataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaa 183  Q
    ||||| |||||||||||||||| |||  ||||||||| | ||||||| ||| |||| |||||| ||  ||||||||||||||| | |   | ||||  ||    
34777975 ataaaaagttatcaagtcttcaaatatgtataaatataatgagtaatttttgtattagattgaccctccatgagaatactacacatt--gacttatgtaa 34777878  T
184 agtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||| | |||||||||    
34777877 agtgtcataagatattttgatagtgata 34777850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 95
Target Start/End: Complemental strand, 9938003 - 9937933
25 catcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttat 95  Q
    |||| ||||||| |||||||| ||| |||||| | |||||||||||||| | |||||| ||||||||||||    
9938003 catcgaagcatatagactattgtgtgggtagagtcatgatcacatctcataaatcatgaataaagagttat 9937933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 316
Target Start/End: Complemental strand, 9937826 - 9937745
235 tgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaag 316  Q
    ||||| |||||||||||||||||||  ||||||| | |||| ||  | ||||||| |||| ||||| |||||||||||||||    
9937826 tgaaatcactatgtaccctagatgtaagagtcgaatactttatcgtcgttcaaacattgttcgtaaaaggatgactataaag 9937745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 114 - 205
Target Start/End: Complemental strand, 9937923 - 9937830
114 taaatattaggagtaatatttatattggattgatccgtcatgagaatactaca---tagtaaaagttataaaaagtgtcataagatattctcata 205  Q
    |||||| ||| |||||||||||||||| | ||| ||||||||||||||||||    |||||  | |||| ||| ||| |||||||||||||||||    
9937923 taaataatagaagtaatatttatattgcagtga-ccgtcatgagaatactactacttagtatgaattatgaaatgtgccataagatattctcata 9937830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 37 - 73
Target Start/End: Original strand, 11421016 - 11421052
37 gagactattatgtaggtagactgatgatcacatctca 73  Q
    |||||||||||||| |||||||||||| |||||||||    
11421016 gagactattatgtatgtagactgatgaccacatctca 11421052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 73
Target Start/End: Complemental strand, 30040784 - 30040740
29 aaagcatagagactattatgtaggtagactgatgatcacatctca 73  Q
    ||||||| ||||||||||||||  ||||||||||| |||||||||    
30040784 aaagcatcgagactattatgtatatagactgatgaccacatctca 30040740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 46)
Name: chr3

Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 6110230 - 6110551
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6110230 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 6110329  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
6110330 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 6110429  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
6110430 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 6110529  T
323 gatgggtactccatgaatcatg 344  Q
6110530 gatgggtactccatgaatcatg 6110551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 16482524 - 16482203
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16482524 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 16482425  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
16482424 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 16482325  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
16482324 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 16482225  T
323 gatgggtactccatgaatcatg 344  Q
16482224 gatgggtactccatgaatcatg 16482203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 10579396 - 10579075
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10579396 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 10579297  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||    
10579296 ggagtaatatttatattggattgatccgccatgagaatactacataataaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 10579197  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
10579196 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 10579097  T
323 gatgggtactccatgaatcatg 344  Q
10579096 gatgggtactccatgaatcatg 10579075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15600925 - 15600604
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15600925 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 15600826  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15600825 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15600726  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
15600725 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15600626  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||| ||||||||||||    
15600625 gatgggtaccccatgaatcatg 15600604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15607470 - 15607149
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15607470 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 15607371  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15607370 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15607271  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
15607270 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15607171  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||| ||||||||||||    
15607170 gatgggtaccccatgaatcatg 15607149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 10572633 - 10572312
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10572633 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 10572534  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||    
10572533 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaactgtcataagatattctcatagtgatagtggtgtattc 10572434  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10572433 cacccttcgacctgaaaccactatgtaccgtagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 10572334  T
323 gatgggtactccatgaatcatg 344  Q
10572333 gatgggtactccatgaatcatg 10572312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15342260 - 15341939
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
15342260 atcattaaaacatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatctagtcttcacatagatataaaaatta 15342161  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
15342160 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaaattatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15342061  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
15342060 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15341961  T
323 gatgggtactccatgaatcatg 344  Q
15341960 gatgggtactccatgaatcatg 15341939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18520141 - 18520462
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18520141 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18520240  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18520241 ggagtaatatttatatttgattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18520340  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
18520341 cacccttcgaactgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccataacaggatgactataaagttggtt 18520440  T
323 gatgggtactccatgaatcatg 344  Q
18520441 gatgggtactccatgaatcatg 18520462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 38 - 344
Target Start/End: Original strand, 8490676 - 8490982
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8490676 agacgattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 8490775  T
138 ttggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctga 237  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8490776 ttggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctga 8490875  T
238 aaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatg 337  Q
8490876 aaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatg 8490975  T
338 aatcatg 344  Q
8490976 aatcatg 8490982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 30 - 340
Target Start/End: Original strand, 18522836 - 18523146
30 aagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaa 129  Q
18522836 aagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaa 18522935  T
130 tatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccctt 229  Q
    ||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||    
18522936 tatttatattggattgatccgccatgaaaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtatttcaccctt 18523035  T
230 cgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggt 329  Q
18523036 cgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggt 18523135  T
330 actccatgaat 340  Q
18523136 actccatgaat 18523146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15357627 - 15357306
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
15357627 atcattaaaacatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatctagtcttcacatagatataaaaatta 15357528  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15357527 ggagtaatatttatattgggttgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15357428  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
15357427 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15357328  T
323 gatgggtactccatgaatcatg 344  Q
15357327 gatgggtactccatgaatcatg 15357306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 17781159 - 17780838
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
17781159 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacaaatcatagataaagagttatcaagtcttcacatagatataaatatta 17781060  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
17781059 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaaattatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17780960  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
17780959 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaataggatgactataaagttggtt 17780860  T
323 gatgggtactccatgaatcatg 344  Q
17780859 gatgggtactccatgaatcatg 17780838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 13211468 - 13211789
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
13211468 atcattaaagcatagagactattatgtaggtagactgatgatcacaactcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 13211567  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
13211568 ggagtaatatttatattggattgatccgccatgagaatattacatagtaaaagttatgaaaagtgtcataatatattctcatagtgatagtggtgtattc 13211667  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13211668 cacccttcgacctgaaaccattatgtaacctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 13211767  T
323 gatgggtactccatgaatcatg 344  Q
13211768 gatgggtactccatgaatcatg 13211789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 29 - 344
Target Start/End: Original strand, 13248779 - 13249094
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13248779 aaagcatagagactattatgtaggtagactgatgatcacaactcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 13248878  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||||||||||||| || |||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
13248879 atatttatattggattgattcgccatgagaatattacatagtaaaagttatgaaaagtgtcataatatattctcatagtgatagtggtgtattccaccct 13248978  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13248979 tcgacctgaaaccactatgtaacctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 13249078  T
329 tactccatgaatcatg 344  Q
13249079 tactccatgaatcatg 13249094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 32056941 - 32056619
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaa-tatt 121  Q
    ||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
32056941 atcattaaagcatagagactattatgtgggtagactaatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaaatatt 32056842  T
122 aggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtatt 221  Q
    | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
32056841 atgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtatt 32056742  T
222 ccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 321  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32056741 ccacccttcaacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 32056642  T
322 tgatgggtactccatgaatcatg 344  Q
    |||||| ||||||||||||||||    
32056641 tgatggatactccatgaatcatg 32056619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 23 - 348
Target Start/End: Complemental strand, 17200225 - 17199900
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17200225 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagatcgtggataaagagttatcaagtcttcacatagatataaatatta 17200126  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||| ||||| ||||||||||| |||  ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17200125 ggagtagtatttgtattggattgacccgctatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17200026  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||| |||| ||||||||||||||||||||||    
17200025 cacccttcgacctgaaaccactatgtaccttagatgttggagtcgagtgttttgtcaccattcaaatgttgttcgtatcaggatgactataaagttggtt 17199926  T
323 gatgggtactccatgaatcatgatga 348  Q
17199925 gatgggtactccatgaatcatgatga 17199900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 13516977 - 13517294
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13516977 atcattaaagcacagagactattatgtgggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 13517076  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||  ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||      |    
13517077 ggagtaatatttatattggattgatcctccatgagaatactaaatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtgg----ccc 13517172  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||     
13517173 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttatcaccattcaaacgttgtccgtaacaggatgactataaagttggta 13517272  T
323 gatgggtactccatgaatcatg 344  Q
13517273 gatgggtactccatgaatcatg 13517294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 1647556 - 1647241
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
1647556 aaagcatagagactattatgtggatagactgatgatcacatctcacagatcatggataaagagttatcaagtctacacatagatataaatattaggagta 1647457  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    || |||||||| ||||||  || ||||||||||||||||| |||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||    
1647456 atgtttatatttgattgactcgccatgagaatactacataataaaagttatgaaaagtgtcatacgatattcccatagtgatagtggtgtattccaccct 1647357  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |    
1647356 tcgacctaaaaccactatataccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaatttggttgatgag 1647257  T
329 tactccatgaatcatg 344  Q
1647256 tactccatgaatcatg 1647241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 17136525 - 17136840
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||      ||    
17136525 atcattaaaacatagagactattatgtgggtagactgatgatcacatttcacagatcatggataaagagttatcaagtcttcacatagatat------ta 17136618  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||| ||  ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
17136619 ggagtaatatttatattggattgacccaccatgagaatactacatagtaaaagttattgaaagtgtcataagatattctcatagtgatagtggtgtattc 17136718  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||    
17136719 cacccttcgacttgaaaccactatgtaccctagatgttggagtcgagtgcttagtaaacattcaaacgttgtccgtaacaggatgactataaagttggtt 17136818  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| ||||||||||||||||    
17136819 gatggatactccatgaatcatg 17136840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29925137 - 29925458
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||| ||| ||||||||| | ||||  ||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||    
29925137 atcattaaagcatggaggctattatgtggatagatcgatgatcacatctcatagatcatggataaagagtcattaagtcttcacatagatataaatatta 29925236  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||| ||  |  ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29925237 ggagtaatatttatattggattgacccacctagagaatactgcatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29925336  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||| || |||||||||||| ||||||||||||| |||||||| |||||||||||||||| |||||||||||| |||||| ||||| |||||||||||||    
29925337 caccatttgacctgaaaccattatgtaccctagacgttggagttgagtgctttgtcaccaatcaaacgttgtctgtaacaagatgattataaagttggtt 29925436  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| ||||||| ||||||||    
29925437 gatggatactccacgaatcatg 29925458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29974290 - 29974611
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||| ||| ||||||||| | ||||  ||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||    
29974290 atcattaaagcatggaggctattatgtggatagatcgatgatcacatctcatagatcatggataaagagtcattaagtcttcacatagatataaatatta 29974389  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||| ||  |  ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29974390 ggagtaatatttatattggattgacccacctagagaatactgcatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29974489  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||| || |||||||||||| ||||||||||||| |||||||| |||||||||||||||| |||||||||||| |||||| ||||| |||||||||||||    
29974490 caccatttgacctgaaaccattatgtaccctagacgttggagttgagtgctttgtcaccaatcaaacgttgtctgtaacaagatgattataaagttggtt 29974589  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| ||||||| ||||||||    
29974590 gatggatactccacgaatcatg 29974611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 54 - 344
Target Start/End: Original strand, 16200627 - 16200917
54 agactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtca 153  Q
    ||||||||||||| |||| |||||||||||||||||| ||||||||| |||| ||||||| |||||||||| |||||||| |||||||||||| ||  ||    
16200627 agactgatgatcatatcttacagatcatggataaagaattatcaagtattcatatagatacaaatattaggtgtaatattcatattggattgacccacca 16200726  T
154 tgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccct 253  Q
    ||||||||||||||||| ||| ||||  ||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||    
16200727 tgagaatactacatagtcaaaattatgtaaagtatcataagatattctcatagtgatagtggtgtattcaaccctttgacctgaaaccactatgtaccct 16200826  T
254 agatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    |||||||| |||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||| ||||||| ||||||||    
16200827 agatgttgaagtcgagtgctttgtcaccattcaaatgttgtctgtaacaagatgactataaagttggttgatggatactccacgaatcatg 16200917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 21034238 - 21034540
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
21034238 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 21034336  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
21034337 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 21034433  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
21034434 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 21034532  T
337 gaatcatg 344  Q
21034533 gaatcatg 21034540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 15846838 - 15846536
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
15846838 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 15846740  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
15846739 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 15846643  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || |||| |||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
15846642 aaaccactatgatccctagatg-tggactcaagtgttttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 15846544  T
337 gaatcatg 344  Q
15846543 gaatcatg 15846536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 20147856 - 20147554
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
20147856 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 20147758  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
20147757 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 20147661  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
20147660 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 20147562  T
337 gaatcatg 344  Q
20147561 gaatcatg 20147554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 21398792 - 21399094
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| ||||||| |||| | |||||||  | |||| ||||  ||| ||||||||||  |||||| |||||||||||||||||||||||||    
21398792 gagactattatgtatgtagacttatgacctcatctcatgggtcatagatat-gagatatcaagtctatacataggtataaatattaggagtaatatttat 21398890  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||| | | ||||| |  |||||  | | ||| ||||||    
21398891 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattcttacaatgataataatgtatatcgctcttagacctg 21398987  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
21398988 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 21399086  T
337 gaatcatg 344  Q
21399087 gaatcatg 21399094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 29 - 326
Target Start/End: Complemental strand, 24253423 - 24253130
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| |||||||| ||||||| |||||||  || ||||||||||||||||||||| ||||||||  |||||| |||| ||||     
24253423 aaagcatagagactattatgtcggtagactaatgatcatatctcacgaattatggataaagagttatcaagttttcacatacttataaacattaagagtt 24253324  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||||||| |||| ||  |||||||||| | |||||  || |||||   |||  ||||||| ||||||||||||||||  ||||||||||| | |    
24253323 atatttatattggtttgaccctccatgagaataatgcatag--aatgttat-ttaaggatcataagttattctcatagtgataacggtgtattcca-cat 24253228  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatg 326  Q
    ||||||| ||||||||||||||| |||||||  || |||||| ||||||   | ||||||| |||||  | ||||  |||| |||||||| |||||||    
24253227 tcgacctaaaaccactatgtaccttagatgtatgactcgagtactttgttgtcgttcaaacattgtcaattacagagtgaccataaagttagttgatg 24253130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 14890391 - 14890693
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
14890391 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 14890489  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
14890490 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 14890586  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    ||| |||| ||  | ||||||| |||| || ||||||||||   ||||| ||||||||| |||| ||||| | ||||| |||||||||||||||||  ||    
14890587 aaagcactgtgatctctagatg-tggactcaagtgctttgttgtcattctaacgttgtctgtaaaaggataattataacgttggttgatgggtacttgat 14890685  T
337 gaatcatg 344  Q
14890686 gaatcatg 14890693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 55427021 - 55427323
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
55427021 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 55427119  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
55427120 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 55427216  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
55427217 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 55427315  T
337 gaatcatg 344  Q
55427316 gaatcatg 55427323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 12299911 - 12300212
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||   ||||||||||||| |||||||||||||||||    
12299911 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctat-catagatataaatgttaggagtaatatttat 12300008  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
12300009 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 12300105  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || |||| |||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
12300106 aaaccactatgatctctagatg-tggactcaagtgatttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 12300204  T
337 gaatcatg 344  Q
12300205 gaatcatg 12300212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 105 - 344
Target Start/End: Complemental strand, 25978963 - 25978728
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| ||||| |||||||||||||||||||| ||||| || ||  | |||||||||||||||||||  ||||| | |  ||||||||||||||||||     
25978963 acataggtataattattaggagtaatatttatactggatagacccaccgtgagaatactacatagtaa--gttatgagat-tgtcataagatattctcac 25978867  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| | ||||||  | | ||| |||||||||||||||||  |||||||||| ||| || ||| ||||||  |||||| ||||||||| |||| |||    
25978866 aatgataatagtgtatatcgctcttagacctgaaaccactatgatccctagatgt-ggactcaagtactttgttgccattctaacgttgtctgtaaaagg 25978768  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    || || |||| |||||||||||||||||  ||||||||||    
25978767 ataaccataacgttggttgatgggtacttgatgaatcatg 25978728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 29 - 246
Target Start/End: Original strand, 14147013 - 14147226
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||| |||||||||||| || |||||||||||| |||||||||  | |||||||||  ||| ||| ||||||  |||||  ||||||||||||||| |    
14147013 aaagcacagagactattatatatgtagactgatgaccacatctcatgggtcatggatat-gagatattaagtctatacatatgtataaatattaggagga 14147111  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| |||||||| | | | ||||||| |||||||||  | ||||| |||| |||| ||||||||||||| | |||||  |||||||  ||| ||    
14147112 atatttatactggattgacctgccgtgagaatgctacatagt--atgttatgaaaa-tgtcgtaagatattctcacattgataaaggtgtatatcactct 14147208  T
229 tcgacctgaaaccactat 246  Q
    | ||||||||||||||||    
14147209 tagacctgaaaccactat 14147226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 112 - 310
Target Start/End: Original strand, 15526827 - 15527021
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    ||||||| |||||||||||||||||| |||||||| || || ||||| ||||| ||||||   | ||| |||| |||||||||||||||| | | || ||    
15526827 tataaatcttaggagtaatatttatactggattgacccatcgtgagagtactaaatagtat--gctatgaaaa-tgtcataagatattcttacaatgtta 15526923  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgact 310  Q
     |||||||| |||| ||| |||||||||||||||||  || || ||| |||| || |||||||| | ||||||||||||||||| ||||||| ||||||    
15526924 atggtgtataccactcttagacctgaaaccactatgatccatacatg-tggactcaagtgctttataaccattcaaacgttgtctgtaacagcatgact 15527021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 186 - 344
Target Start/End: Original strand, 28088251 - 28088408
186 tgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattc 285  Q
    |||||||||||||||||| | ||||| | ||||||  | | ||| |||||||||||||||||  ||||||||| |||| || || |||||||  ||||||    
28088251 tgtcataagatattctcacaatgataatagtgtatatcgctcttagacctgaaaccactatgatccctagatg-tggactcaagggctttgttgccattc 28088349  T
286 aaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
     ||||||||| |||| ||||| || |||| |||||||||||| ||||  ||||||||||    
28088350 taacgttgtctgtaaaaggataaccataacgttggttgatggatacttgatgaatcatg 28088408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 105 - 344
Target Start/End: Original strand, 11787654 - 11787889
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||||||||||||||||||||||| ||||| || ||  | |||||||||||||||||  |||||||  | | | ||||||||||||||||     
11787654 acataggtataaatattaggagtaatatttatactggatagacccaccgtgagaatactacatagt--aagttat-gatattttcataagatattctcac 11787750  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| |  |||||  | | ||| |||||||||||| ||||  ||||||||  |  | || ||| ||||||  |||||| ||||||||| ||||  ||    
11787751 aatgataatattgtatatcgctcttagacctgaaaccattatgatccctagat-ctataatcaagtactttgttgccattctaacgttgtctgtaaatgg 11787849  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    || || |||| |||||||||||||||||  ||||||||||    
11787850 ataaccataacgttggttgatgggtacttaatgaatcatg 11787889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 40 - 344
Target Start/End: Complemental strand, 15317472 - 15317176
40 actattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatatt 139  Q
    ||||||||||| ||||| |||||| | |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||| |    
15317472 actattatgtatgtagattgatgaccgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttatact 15317374  T
140 ggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaa 239  Q
     ||| || ||  | |||||||||||||||||  | |||||  | | |||||||||||||||||| | ||||| | |||||   | | ||| |||||||||    
15317373 agatagacccaccgtgagaatactacatagt--acgttat-gagattgtcataagatattctcacaatgataatagtgtaaatcgctcttagacctgaaa 15317277  T
240 ccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaa 339  Q
    ||||||||  ||||||||| |||| || ||| ||||||   ||||| ||||||||| ||||  |||| |  |||| ||||||||| |||||||  |||||    
15317276 ccactatgatccctagatg-tggactcaagtactttgt---cattctaacgttgtctgtaaacggataatcataacgttggttgacgggtacttgatgaa 15317181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 76 - 205
Target Start/End: Original strand, 28953965 - 28954093
76 gatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattt-atattggattgatccgtcatgagaatactacatagtaaaa 174  Q
    |||||| ||||||||||||  |||||||||||||  |||| | ||||||||||||||||  | ||||||| | || ||||||||||||||||||  | ||    
28953965 gatcattgataaagagttacaaagtcttcacatatgtatacacattaggagtaatatttgttgttggattaacccatcatgagaatactacata--ataa 28954062  T
175 gttataaaaagtgtcataagatattctcata 205  Q
    |||||  ||||||||||| ||||||||||||    
28954063 gttatttaaagtgtcatatgatattctcata 28954093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 19089786 - 19089734
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcaca 75  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
19089786 atcattaaatcatagagactattatgtaggtagactgatgatcacatctcaca 19089734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 78 - 270
Target Start/End: Original strand, 32280313 - 32280507
78 tcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagtt 177  Q
    ||||||||||||||||||  | ||||||||||| |||||  |||| || ||||||||| | | | |||| ||   ||||||||| |||||||| |  ||     
32280313 tcatggataaagagttatttaatcttcacataggtataatcattacgaataatatttacactcggttgacccacaatgagaataatacatagtga--gtc 32280410  T
178 ataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccac----tatgtaccctagatgttggagtcgagt 270  Q
    ||  |||||||||||||||||||||||||||||| || | ||||  ||| ||  || |||||||||    |||||||||||||||| ||||||||||    
32280411 atgtaaagtgtcataagatattctcatagtgataatgatttattttaccttttcacttgaaaccactatatatgtaccctagatgtaggagtcgagt 32280507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 29 - 122
Target Start/End: Original strand, 9504455 - 9504548
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    |||| ||||| |||||||||| ||||||||||| |||  ||||||| | |||||||||| |||||||||||| || ||||| ||| ||||||||    
9504455 aaaggatagaaactattatgtgggtagactgataatcttatctcacgggtcatggataaggagttatcaagtattaacatacataaaaatatta 9504548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 148
Target Start/End: Complemental strand, 8252048 - 8251933
33 catagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    |||| ||||||| |||| | | |||||| |||||||||| || ||||||| |||||  |||||||| |||| ||||| || || |||||  |||||||||    
8252048 catatagactatcatgtggatggactgaagatcacatcttacggatcatgaataaaatgttatcaaatctttacataaatttacatatttcgagtaatat 8251949  T
133 ttatattggattgatc 148  Q
    ||||||| ||||||||    
8251948 ttatatttgattgatc 8251933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 306
Target Start/End: Original strand, 30464147 - 30464261
191 taagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacg 290  Q
    ||||||||||||||| ||||| |||| ||| |||| ||| |||||||||||||||||  ||||||||| |||| || |||| ||| |   ||||||||||    
30464147 taagatattctcataatgataatggtctataccactcttagacctgaaaccactatgatccctagatg-tggactcaagtgttttattgacattcaaacg 30464245  T
291 ttgtccgtaacaggat 306  Q
    ||||| |||| |||||    
30464246 ttgtctgtaaaaggat 30464261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 16200291 - 16200363
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatc 96  Q
    ||||| ||||||| ||||||||| ||| |  ||||||||||||| |||| ||||||||||||||||||||||||    
16200291 atcattaaagcatggagactatt-tgtggagagactgatgatcatatcttacagatcatggataaagagttatc 16200363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 247
Target Start/End: Complemental strand, 36138097 - 36138033
183 aagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    ||||| |||||||||||  || ||||||| |||||||| ||||||||| |||||||| |||||||    
36138097 aagtgccataagatatttccaaagtgataatggtgtataccacccttcaacctgaaatcactatg 36138033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 116 - 168
Target Start/End: Original strand, 4189223 - 4189275
116 aatattaggagtaatatttatattggattgatccgtcatgagaatactacata 168  Q
    ||||||| |||||||||||||| |  ||||||| |||||||||||| ||||||    
4189223 aatattatgagtaatatttatactatattgatctgtcatgagaatattacata 4189275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 247
Target Start/End: Original strand, 36142816 - 36142880
183 aagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    ||||| |||||||||||  || ||||||| || |||||  |||||||| ||||||||||||||||    
36142816 aagtgccataagatatttccaaagtgataatgatgtatgtcacccttcaacctgaaaccactatg 36142880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 38)
Name: chr1

Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18252196 - 18252517
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18252196 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18252295  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18252296 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18252395  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
18252396 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18252495  T
323 gatgggtactccatgaatcatg 344  Q
18252496 gatgggtactccatgaatcatg 18252517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 18532555 - 18532234
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18532555 atcattaaagcatagagactattatgtagatagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18532456  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18532455 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18532356  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
18532355 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18532256  T
323 gatgggtactccatgaatcatg 344  Q
18532255 gatgggtactccatgaatcatg 18532234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27131450 - 27131130
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27131450 atcattaaagcataaagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 27131351  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
27131350 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 27131251  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27131250 cacccttcgacctgaaaccactatgta-cctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 27131152  T
323 gatgggtactccatgaatcatg 344  Q
27131151 gatgggtactccatgaatcatg 27131130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27310618 - 27310297
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||    
27310618 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagattatggataaagagttatcaagtcttcacataaatataaatatta 27310519  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||    
27310518 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattcttatagtgatagtggtgtattc 27310419  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
27310418 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtctgtaacaggatgactataaagttggtt 27310319  T
323 gatgggtactccatgaatcatg 344  Q
27310318 gatgggtactccatgaatcatg 27310297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 16359076 - 16358755
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||    
16359076 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagataatggataaagagttatcaagccttcacatagatataaatatta 16358977  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||    
16358976 tgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgagaagtgtcataagatattctcatagtgatagtggtgtattc 16358877  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16358876 cacccttcgtcttgaaaccaccatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactttaaagttggtt 16358777  T
323 gatgggtactccatgaatcatg 344  Q
16358776 gatgggtactccatgaatcatg 16358755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 3855954 - 3855639
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||| |||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
3855954 aaagcatggagactattacgtgggtagactgatgatcacatctcacaaatcatggataaagagttataaagtcttcacataggtataaatattaggagta 3855855  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    |||||||||||||||||| |||  ||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||| |    
3855854 atatttatattggattgacccgcaatgagaatactacatagtaaaggttatgaaaagtgtcataagatattctcacagtgatagtggtgtattccaccat 3855755  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    |||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||  ||    
3855754 tcgacccgaaaccactatgtaccctagatgttggagttgagcgctttgtcaccattcaagcgttgtccgtaacaggatgactataaagttggttgaccgg 3855655  T
329 tactccatgaatcatg 344  Q
3855654 tactccatgaatcatg 3855639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 36816668 - 36816354
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
36816668 aaagcatagagactattatgtggatagactgatgatcacatctcacagatcatggataaagagttatcaagtctacacatagatataaatattaggagta 36816569  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    |||||||||||||||||| ||  |||||||||||||||||||||||||||| ||||||||||||| | ||| |||||||||| |||||||||||||||||    
36816568 atatttatattggattgacccaccatgagaatactacatagtaaaagttatgaaaagtgtcataa-aaattatcatagtgatggtggtgtattccaccct 36816470  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | || |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||| ||| |||||||||||||||||| ||    
36816469 ttgaactgaaaccactatgtaccctagatgttggagtcgagcgttttgtcaccattcaaacgttgtctgtaacaagataactataaagttggttgatagg 36816370  T
329 tactccatgaatcatg 344  Q
    |||||||  |||||||    
36816369 tactccacaaatcatg 36816354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 63 - 344
Target Start/End: Complemental strand, 22641871 - 22641594
63 atcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatac 162  Q
    ||||||||||| ||||||||||||||||||||| |||| |||||||||||||||   |||||| ||||||||||| | |||||| ||  |||||||| ||    
22641871 atcacatctcatagatcatggataaagagttattaagtgttcacatagatataa---ttaggaataatatttatactagattgacccaccatgagaa-ac 22641776  T
163 tacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttgg 262  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
22641775 tacatagtaaaagttataaaaagtgtcataagatattctcacagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccgtagatgttgg 22641676  T
263 agtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| ||||||||    
22641675 agtcgagtgctttgtcaccattcaaacgttgtctgtaacaagatgactataaagttggtcgatgggtactccacgaatcatg 22641594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 27277592 - 27277278
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| ||||||| |||||||||||||||| |||||| ||||||||||||||| || ||||||||| |||||||||||||||||    
27277592 aaagcatagagactattatgtgggtagaccgatgatcacatctcacggatcatagataaagagttatcatgttttcacataggtataaatattaggagta 27277493  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| | |||||| ||  ||| |||||| | |||||||||||| || ||| ||| ||||||||||||| ||||||||||||||||||||||||||    
27277492 atatttatactagattgacccaccataagaatattgcatagtaaaagtcatgaaa-gtgccataagatattcttatagtgatagtggtgtattccaccct 27277394  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | ||||||||||||||||||||||| ||||||||||||||||||||| |||  |||||||| ||||  |||||| |||||| |||||||||||||| |||    
27277393 ttgacctgaaaccactatgtaccctggatgttggagtcgagtgctttatcataattcaaacattgtttgtaacaagatgaccataaagttggttgaaggg 27277294  T
329 tactccatgaatcatg 344  Q
    |||||||| |||||||    
27277293 tactccataaatcatg 27277278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 23 - 216
Target Start/End: Complemental strand, 21171274 - 21171081
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21171274 atcattaaagcataaagactattatgtgggtagactgatgataacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 21171175  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggt 216  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
21171174 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggt 21171081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 19706741 - 19706439
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
19706741 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 19706643  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
19706642 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 19706546  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
19706545 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 19706447  T
337 gaatcatg 344  Q
19706446 gaatcatg 19706439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 43802667 - 43802365
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
43802667 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 43802569  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
43802568 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 43802472  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
43802471 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 43802373  T
337 gaatcatg 344  Q
43802372 gaatcatg 43802365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 28135025 - 28134723
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    ||||| |||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
28135025 gagacaattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 28134927  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||||||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
28134926 attggattgatccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 28134830  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||| ||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
28134829 aaaccactatgatccctaaatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 28134731  T
337 gaatcatg 344  Q
28134730 gaatcatg 28134723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 23 - 177
Target Start/End: Complemental strand, 22657262 - 22657108
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||| |||| | ||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||||||||||||||||    
22657262 atcattaaagcatagagactatcatgtggatagactgatgatcacatctcatagctcatagataaagagttattaagtcttcacatagatataaatatta 22657163  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagtt 177  Q
     |||||||||||||||| |||||| ||  |||| |||||||||||||||||||||    
22657162 tgagtaatatttatattagattgacccaccatgtgaatactacatagtaaaagtt 22657108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 53 - 344
Target Start/End: Original strand, 23507096 - 23507385
53 tagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtc 152  Q
    |||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| | ||  |    
23507096 tagactgatgatcacatctcacggatcatggataaggagttatcaagttttcacatagatataaataataggagtaatatttatattggattaacccacc 23507195  T
153 atgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtattccacccttcgacctgaaaccactatgtacc 251  Q
    || ||||| ||||| || |     | |||||||   |||||| ||||||||||||||| ||||| ||||  || ||||||||||||||||||| ||||||    
23507196 attagaatgctacagagaacgttgtgtaaaaag---cataagttattctcatagtgataagtggagtatgtcatccttcgacctgaaaccactgtgtacc 23507292  T
252 ctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||  || | |||| |||||| | ||| ||||    ||| |||| |||||||||||||| | | || ||||||||||||| |||||||    
23507293 ctagatgtaagatttgagtactttgttatcatacaaataccgtctgtaataggatgactataaattcgatttatgggtactccataaatcatg 23507385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 9456116 - 9456418
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
9456116 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 9456214  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
9456215 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 9456311  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
9456312 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 9456410  T
337 gaatcatg 344  Q
9456411 gaatcatg 9456418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 151 - 344
Target Start/End: Complemental strand, 9916689 - 9916497
151 tcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata-gtggtgtattccacccttcgacctgaaa-ccactatgt 248  Q
    |||||||||||||||||||  ||||||||  ||| ||||||||  |||||||||||||||| |||||||||||||||||||||||||||| |||||||||    
9916689 tcatgagaatactacatag--aaagttatgtaaa-tgtcataaattattctcatagtgataagtggtgtattccacccttcgacctgaaaaccactatgt 9916593  T
249 accctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||| |||||||||| |||||| ||| | |||||||||||||||||| | ||||||||||||| ||| ||| || ||||| ||||||||    
9916592 accctagatgtaggagtcgagtactttgttaccgtccaaacgttgtccgtaacaaggtgactataaagttagtttatgagttctccacgaatcatg 9916497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 12014319 - 12014084
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||| || |||| ||||||| |||||| ||||||||||||||||| |||||| ||||| ||||||||||||||||||||| |||||||||||| |||||    
12014319 aaagcgtaaagaccattatgtgggtagaatgatgatcacatctcacggatcattgataaggagttatcaagtcttcacataaatataaatattaagagta 12014220  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtattccaccc 227  Q
    ||||| |||||||||||| ||| |||||||||  ||||||| | ||  | ||||||   ||| |||  |||||||||||||| ||||||||||| |||||    
12014219 atattaatattggattgacccggcatgagaatgttacatagaacaatatgtaaaaa---tcacaagtcattctcatagtgataagtggtgtatttcaccc 12014123  T
228 ttcgacctgaaaccactatgtaccctagatgttggagtc 266  Q
    ||| |||| ||| |||| ||||| |||||||| ||||||    
12014122 ttcaacctaaaatcactgtgtactctagatgtaggagtc 12014084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 20391541 - 20391239
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||| |||||||||||||||||    
20391541 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatgttaggagtaatatttat 20391443  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||||  ||||| |||  | |||||||||||||||| | ||||| |  ||||| || | ||| ||||||    
20391442 attggattgacccactgtgagaatactacatagtaa--gttatgaaattt-tcataagatattctcacaatgataataatgtataccgctcttagacctg 20391346  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | |||||||| ||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
20391345 aaaccactatgatctctagatgt-ggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 20391247  T
337 gaatcatg 344  Q
20391246 gaatcatg 20391239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 20779947 - 20779645
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
20779947 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 20779849  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
20779848 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 20779752  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
20779751 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 20779653  T
337 gaatcatg 344  Q
20779652 gaatcatg 20779645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 22670559 - 22670257
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
22670559 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 22670461  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
22670460 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 22670364  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
22670363 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 22670265  T
337 gaatcatg 344  Q
22670264 gaatcatg 22670257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 42817291 - 42816989
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
42817291 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 42817193  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
42817192 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 42817096  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
42817095 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 42816997  T
337 gaatcatg