View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_3 (Length: 573)

Name: NF0095_high_3
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_3
NF0095_high_3
[»] chr2 (14 HSPs)
chr2 (29-568)||(33519366-33519905)
chr2 (199-499)||(33496221-33496521)
chr2 (60-109)||(33496179-33496228)
chr2 (134-198)||(20539719-20539783)
chr2 (134-198)||(23717977-23718040)
chr2 (134-198)||(24105649-24105712)
chr2 (134-199)||(19536443-19536508)
chr2 (134-197)||(21624217-21624280)
chr2 (134-198)||(21091674-21091737)
chr2 (134-197)||(38117204-38117261)
chr2 (138-188)||(4142889-4142939)
chr2 (169-199)||(37419703-37419733)
chr2 (134-199)||(6940204-6940269)
chr2 (134-198)||(21782863-21782927)
[»] chr5 (10 HSPs)
chr5 (134-198)||(19820439-19820503)
chr5 (134-200)||(22013362-22013428)
chr5 (134-198)||(2436878-2436936)
chr5 (134-198)||(37328889-37328953)
chr5 (134-198)||(42469171-42469235)
chr5 (134-187)||(22299525-22299578)
chr5 (134-189)||(15382436-15382491)
chr5 (134-189)||(21522709-21522764)
chr5 (134-189)||(21533275-21533330)
chr5 (134-198)||(6247572-6247636)
[»] chr7 (14 HSPs)
chr7 (134-198)||(27944991-27945055)
chr7 (134-199)||(24105628-24105692)
chr7 (134-197)||(49107773-49107835)
chr7 (134-198)||(21864756-21864820)
chr7 (134-198)||(43027514-43027578)
chr7 (134-197)||(598160-598222)
chr7 (134-189)||(11061121-11061176)
chr7 (134-189)||(24339601-24339656)
chr7 (134-189)||(26733263-26733318)
chr7 (138-183)||(11722147-11722192)
chr7 (134-183)||(17851396-17851445)
chr7 (134-198)||(2034392-2034455)
chr7 (166-198)||(7328768-7328800)
chr7 (146-198)||(33994162-33994214)
[»] scaffold0223 (1 HSPs)
scaffold0223 (134-198)||(20122-20186)
[»] chr6 (16 HSPs)
chr6 (134-198)||(853904-853968)
chr6 (134-198)||(8365564-8365628)
chr6 (134-196)||(12696277-12696338)
chr6 (134-198)||(3398569-3398633)
chr6 (134-198)||(4877890-4877956)
chr6 (134-189)||(9027137-9027192)
chr6 (129-183)||(5000666-5000720)
chr6 (134-196)||(9658832-9658893)
chr6 (134-198)||(6389693-6389757)
chr6 (134-199)||(10294050-10294121)
chr6 (134-198)||(30866189-30866253)
chr6 (134-189)||(7938075-7938130)
chr6 (134-189)||(16766656-16766711)
chr6 (134-183)||(7977875-7977924)
chr6 (134-183)||(9107415-9107464)
chr6 (166-199)||(10649277-10649310)
[»] chr3 (13 HSPs)
chr3 (134-198)||(8842280-8842344)
chr3 (134-201)||(8383204-8383271)
chr3 (134-199)||(4466645-4466710)
chr3 (136-189)||(4991014-4991067)
chr3 (144-197)||(8587076-8587129)
chr3 (134-198)||(55401025-55401089)
chr3 (134-197)||(32429425-32429488)
chr3 (137-199)||(25064858-25064920)
chr3 (134-183)||(10335331-10335380)
chr3 (134-183)||(24205086-24205135)
chr3 (134-183)||(28917966-28918015)
chr3 (166-199)||(34910278-34910311)
chr3 (169-197)||(8789624-8789652)
[»] chr1 (15 HSPs)
chr1 (134-183)||(40917716-40917765)
chr1 (134-182)||(398810-398858)
chr1 (134-198)||(5927385-5927449)
chr1 (152-199)||(39130830-39130877)
chr1 (134-187)||(48040507-48040560)
chr1 (143-199)||(9630634-9630690)
chr1 (134-190)||(10572634-10572690)
chr1 (166-198)||(35702659-35702691)
chr1 (134-189)||(38503279-38503334)
chr1 (134-180)||(20157395-20157441)
chr1 (134-183)||(2896166-2896215)
chr1 (134-179)||(34298405-34298450)
chr1 (138-199)||(34315662-34315722)
chr1 (137-189)||(10577783-10577835)
chr1 (149-181)||(18190160-18190192)
[»] scaffold0306 (1 HSPs)
scaffold0306 (134-198)||(13350-13414)
[»] scaffold0152 (1 HSPs)
scaffold0152 (134-198)||(21913-21977)
[»] chr8 (11 HSPs)
chr8 (134-198)||(126394-126457)
chr8 (134-198)||(25192392-25192456)
chr8 (134-200)||(13437009-13437075)
chr8 (156-198)||(40332155-40332197)
chr8 (134-198)||(28642358-28642422)
chr8 (134-189)||(22651935-22651990)
chr8 (134-189)||(24362247-24362302)
chr8 (134-181)||(29510349-29510396)
chr8 (169-199)||(22595949-22595979)
chr8 (134-198)||(4298931-4298994)
chr8 (134-198)||(11944615-11944679)
[»] scaffold0053 (1 HSPs)
scaffold0053 (134-189)||(8757-8812)
[»] scaffold0018 (1 HSPs)
scaffold0018 (134-195)||(178864-178925)
[»] scaffold0003 (1 HSPs)
scaffold0003 (134-183)||(241559-241608)
[»] scaffold0171 (1 HSPs)
scaffold0171 (135-199)||(23370-23433)
[»] chr4 (6 HSPs)
chr4 (134-189)||(23293031-23293086)
chr4 (169-198)||(7251701-7251730)
chr4 (152-197)||(7670632-7670677)
chr4 (170-199)||(23700420-23700449)
chr4 (166-194)||(482308-482336)
chr4 (138-194)||(28084475-28084531)
[»] scaffold0019 (1 HSPs)
scaffold0019 (134-199)||(71678-71737)
[»] scaffold0361 (1 HSPs)
scaffold0361 (168-197)||(14498-14527)
[»] scaffold0007 (1 HSPs)
scaffold0007 (134-183)||(225313-225362)
[»] scaffold0066 (1 HSPs)
scaffold0066 (166-198)||(33432-33464)
[»] scaffold0020 (1 HSPs)
scaffold0020 (134-198)||(135357-135421)


Alignment Details
Target: chr2 (Bit Score: 491; Significance: 0; HSPs: 14)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 491; E-Value: 0
Query Start/End: Original strand, 29 - 568
Target Start/End: Complemental strand, 33519905 - 33519366
Alignment:
29 aataatagccattcctcaatctttnnnnnnntccattatcaaacattaattgacaaattacttacaagttataaccatatactatgaagcacggatactc 128  Q
    ||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33519905 aataatagccattcctcaatctttaaaaaaatccattatcaaacattaattgacaaattacttacaagttataaccatatactatgaagcacggatactc 33519806  T
129 ctcggattattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatagaccatataacacaatgacaagaacagttgg 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
33519805 ctcggattattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatagaccatataacacaatgacaaaaacagttgg 33519706  T
229 actacatatgagtacctgatcaccaattggaatgccatctctcattcctgttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagtt 328  Q
    ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||     
33519705 actacatatgagtacctgatcaccaattggaatgccatctctcatcccagttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagta 33519606  T
329 gagaggtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctag 428  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33519605 gagaggtagcaatccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctag 33519506  T
429 gcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagttactaa 528  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33519505 gcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagttactaa 33519406  T
529 gaaagaacgatatagccattttcttttaattcatctcact 568  Q
    |||||||||||| ||||||||||||||||||||| |||||    
33519405 gaaagaacgatagagccattttcttttaattcatgtcact 33519366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 199 - 499
Target Start/End: Original strand, 33496221 - 33496521
Alignment:
199 accatataacacaatgacaagaacagttggactacatatgagtacctgatcaccaattggaatgccatctctcattcctgttgtttgcaaaaagcctttt 298  Q
    ||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||| || ||||||| ||    
33496221 accatataacataatgacaagagcagttggactacatacgagtacctgatcaccaattggaatgccatctctcatcccagttgtttccagaaagcctctt 33496320  T
299 attggacgagctgcttcgagagggcaagttgagaggtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctctta 398  Q
    |||||||||||||| ||||| || ||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||    
33496321 attggacgagctgcctcgagtggacaagtagagaggtagcaatccttggcatagagagctccatagttattgatgccaatgaagtccaggctgcctctta 33496420  T
399 ggaggctcttctccttagatgagaacctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaacct 498  Q
    |||| ||||||||||| |  |||| | | |||||| || ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||    
33496421 ggagactcttctccttcgtagagatctttggcaaccggttcccaagaatagagcgcatctcagcagggtactcaccaaaaactaggggatctagtaacct 33496520  T
499 t 499  Q
    |    
33496521 t 33496521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 60 - 109
Target Start/End: Original strand, 33496179 - 33496228
Alignment:
60 tccattatcaaacattaattgacaaattacttacaagttataaccatata 109  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||    
33496179 tccattatcaaacattaattgacaaattacttgcaagttataaccatata 33496228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 20539719 - 20539783
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||||  |||||||| |||| ||||||||| |||||||||||||||||||||||    
20539719 attattagctgtgtcgacgtgtcagtgtccgtgtcgtgtccagtgtccgtatccgtgcttcatag 20539783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 23718040 - 23717977
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||||||||||||||| |||| ||| ||||| ||||| |||||||||||||||||    
23718040 attattagcggtgtcggtgtgtcagtgtccgtgtcatgtcc-gtgtctgtatccgtgcttcatag 23717977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 24105712 - 24105649
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||||||||||||||| |||| ||| ||||| ||||| |||||||||||||||||    
24105712 attattagcggtgtcggtgtgtcagtgtccgtgtcatgtcc-gtgtctgtatccgtgcttcatag 24105649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 19536443 - 19536508
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||||||  ||||||| |||||| | |||| ||||||||||||||||||||| ||||||||||||    
19536443 attattagttgtgtcggcgtgtcattgtccgtgtcgtgtccggtgtccgtatctgtgcttcataga 19536508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 21624280 - 21624217
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    ||||||||| ||||||| |||||||| || | ||||||| ||||||||||||||| ||||||||    
21624280 attattagctgtgtcggcgtgtcagtgtctgtgtcgtgttcggtgtccgtatccgggcttcata 21624217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 21091737 - 21091674
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||||||||||||||| ||||  | |||||| ||||  |||||||||||||||||    
21091737 attattagcggtgtcggtgtgtcagtgtccgtcttgtgtcc-gtgtttgtatccgtgcttcatag 21091674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 197
Target Start/End: Original strand, 38117204 - 38117261
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    ||||||||| ||||||| ||||||||      ||||||||||||||||||||||||||||||||    
38117204 attattagctgtgtcggcgtgtcagt------gtcgtgtccggtgtccgtatccgtgcttcata 38117261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 138 - 188
Target Start/End: Original strand, 4142889 - 4142939
Alignment:
138 ttagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccg 188  Q
    |||| |||||||| |||||||| |||| ||||||| |||||||||||||||    
4142889 ttagtggtgtcggcgtgtcagtgtccgggtcgtgttcggtgtccgtatccg 4142939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 169 - 199
Target Start/End: Complemental strand, 37419733 - 37419703
Alignment:
169 gtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||||||||||||||||||||||||||||    
37419733 gtgtccggtgtccgtatccgtgcttcataga 37419703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 199
Target Start/End: Complemental strand, 6940269 - 6940204
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||||||| ||||||| |||||||| |||| ||||| |  | |||||||||||||| ||||||||    
6940269 attattagctgtgtcggcgtgtcagtgtccgtgtcgtatttgatgtccgtatccgtgtttcataga 6940204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 21782863 - 21782927
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||||| |||||||| |  | ||||||||| ||||| |||| ||||||||||||    
21782863 attattagcagtgtcggcgtgtcagtgtttgtgtcgtgtccagtgtctgtattcgtgcttcatag 21782927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 4e-21; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 19820439 - 19820503
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||    
19820439 attattagcggtgtcggagtgtcagtgtccgtgtcgtgtccggtgtccgtatccgtgcttcatag 19820503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 134 - 200
Target Start/End: Complemental strand, 22013428 - 22013362
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatagac 200  Q
    ||||||||| ||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||    
22013428 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgtatccgtgcttcatagac 22013362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 2436936 - 2436878
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||||||||||| ||||||||      |||||||||||||||||||||||||||||||||    
2436936 attattagcggtgtcggcgtgtcagt------gtcgtgtccggtgtccgtatccgtgcttcatag 2436878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 37328889 - 37328953
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||| || |||||||||| ||||| |||| ||||||| |||||||||| ||||||||||||||    
37328889 attatttgctgtgtcggtgtatcagtgtccgtgtcgtgttcggtgtccgtgtccgtgcttcatag 37328953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 42469235 - 42469171
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||| | ||||||| |||||| |||||| ||||||| |||||||||| ||||||||||||||    
42469235 attattatccgtgtcggcgtgtcattatccgtgtcgtgttcggtgtccgtgtccgtgcttcatag 42469171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 187
Target Start/End: Original strand, 22299525 - 22299578
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatcc 187  Q
    ||||||||| |||||||||||||| |||||| ||||| |||||||||| |||||    
22299525 attattagctgtgtcggtgtgtcaatatccgtgtcgtatccggtgtccatatcc 22299578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 15382491 - 15382436
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||| | |||| |||||||||||||||||| |||||    
15382491 attattagctgtgtcggcgtgtcattgtccgtgtcgtgtccggtgtccgtgtccgt 15382436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 21522764 - 21522709
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||||| |||| ||||||||||||| |||| |||||    
21522764 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgaccgtgtccgt 21522709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 21533330 - 21533275
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||||| |||| ||||||||||||| |||| |||||    
21533330 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgaccgtgtccgt 21533275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 6247636 - 6247572
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||  ||||||| |||||||| | ||  |||||||||||||||| ||||||| |||||||    
6247636 attattagatgtgtcggcgtgtcagtgtgcgtatcgtgtccggtgtccgcatccgtgtttcatag 6247572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 9e-19; HSPs: 14)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 27945055 - 27944991
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||| |||||||| |||||||| |||| |||||||||||||||||||||||||||||||||    
27945055 attattagtggtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgtatccgtgcttcatag 27944991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Complemental strand, 24105692 - 24105628
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||||||| ||||||| |||||||| |||| |||||||||| | |||||||||||||||||||||    
24105692 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccg-tatccgtatccgtgcttcataga 24105628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 49107835 - 49107773
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    |||||||||||||||||||||||||  |||| |||||||||  |||||||||||||| ||||||    
49107835 attattagcggtgtcggtgtgtcagagtccgtgtcgtgtcc-ttgtccgtatccgtgtttcata 49107773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 21864820 - 21864756
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||| ||||||| || |||| |||||||||| |||  |||||||||||||||||    
21864820 attattagctgtgtccgtgtgtccgtgtccgtgtcgtgtccgatgtgtgtatccgtgcttcatag 21864756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 43027514 - 43027578
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| | ||||  |||||||| |||| ||||||||| ||||||| |||||||||||||||    
43027514 attattagctgggtcgccgtgtcagtgtccgtgtcgtgtccagtgtccgcatccgtgcttcatag 43027578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 598222 - 598160
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    |||||||||||||||| ||||||||| |||| ||| |||| ||||||||| | |||||||||||    
598222 attattagcggtgtcgatgtgtcagtgtccgtgtcatgtctggtgtccgtgt-cgtgcttcata 598160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 11061121 - 11061176
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| |||||||||||||||| |||| ||||| |||| ||||||| |||||    
11061121 attattagctgtgtcggtgtgtcagtgtccgtgtcgtatccgatgtccgtgtccgt 11061176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 24339656 - 24339601
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||| | |||  ||||||||||||||||||||||||    
24339656 attattagctgtgtcggcgtgtcaatgtccatgtcgtgtccggtgtccgtatccgt 24339601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 26733318 - 26733263
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||||||||||  |||||||| |||| |||||||| |||||| ||||||||    
26733318 attattagcggtgtcgacgtgtcagtgtccgtgtcgtgtctggtgtcggtatccgt 26733263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 138 - 183
Target Start/End: Original strand, 11722147 - 11722192
Alignment:
138 ttagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||||||| |||||||| |||| |||||||||||| |||||    
11722147 ttagcggtgtcggcgtgtcagtgtccgtgtcgtgtccggtatccgt 11722192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 17851445 - 17851396
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    |||||||||||| ||| |||||| ||||||  ||||||||||||||||||    
17851445 attattagcggtatcgatgtgtcggtatccatgtcgtgtccggtgtccgt 17851396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 2034455 - 2034392
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||| |||||||  |||| |||||||| |||||||| | | ||||||||||||||||||||    
2034455 attattagtggtgtcgacgtgtaagtatccgtgtcgtgtcag-tatccgtatccgtgcttcatag 2034392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 7328768 - 7328800
Alignment:
166 gtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||| |||||||||||||||||||||||||    
7328768 gtcgtgttcggtgtccgtatccgtgcttcatag 7328800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 146 - 198
Target Start/End: Complemental strand, 33994214 - 33994162
Alignment:
146 gtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||| |||||||| | || ||||||||  |||||||||||||||||||||||    
33994214 gtcggcgtgtcagtgttcgtgtcgtgtcaagtgtccgtatccgtgcttcatag 33994162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 20186 - 20122
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||||| |||||| | |||| ||||||||||||||||||||| |||||||||||    
20186 attattagctgtgtcggcgtgtcattgtccgtgtcgtgtccggtgtccgtatctgtgcttcatag 20122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 853904 - 853968
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||  ||||||| ||||||| ||||| ||||||||||||||||||||||||| |||||||    
853904 attattagttgtgtcggcgtgtcagcatccgtgtcgtgtccggtgtccgtatccgtgattcatag 853968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 8365564 - 8365628
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||  ||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||    
8365564 attattagttgtgtcggcgtgtcagtgtccgtgtcgtgtctggtgtccgtatccgtgcttcatag 8365628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 134 - 196
Target Start/End: Complemental strand, 12696338 - 12696277
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcat 196  Q
    ||||||||| ||||||| |||||||| |||| |||||||||| ||||||||||||||||||||    
12696338 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccg-tgtccgtatccgtgcttcat 12696277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 3398633 - 3398569
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||||| |||||||| |||| ||||||| || ||||||||||| ||||||||||    
3398633 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgttcgatgtccgtatccatgcttcatag 3398569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 4877956 - 4877890
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccg--gtgtccgtatccgtgcttcatag 198  Q
    ||||||||| |||||||||||||| |||||| ||||||| ||  ||||||||||| |||||||||||    
4877956 attattagctgtgtcggtgtgtcactatccgtgtcgtgttcggcgtgtccgtatctgtgcttcatag 4877890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 9027192 - 9027137
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||||||||||| |||||||| |||| ||||||||||| |||||| |||||    
9027192 attattagcggtgtcggcgtgtcagtgtccgtgtcgtgtccggagtccgtgtccgt 9027137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 183
Target Start/End: Original strand, 5000666 - 5000720
Alignment:
129 ctcggattattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    |||| ||||||||||||||||  ||||||||||||| ||| ||||||||||||||    
5000666 ctcgaattattagcggtgtcgacgtgtcagtatccgtgtcatgtccggtgtccgt 5000720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 196
Target Start/End: Complemental strand, 9658893 - 9658832
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcat 196  Q
    ||||||||||||||||| |||||||| |||| ||||||| | ||||| |||||||||||||||    
9658893 attattagcggtgtcggcgtgtcagtgtccgtgtcgtgt-ctgtgtctgtatccgtgcttcat 9658832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 6389757 - 6389693
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||| | ||||||| |||| ||| |||| ||||||||||||||| || ||||||||||||||    
6389757 attattatccgtgtcggcgtgtgagtgtccgtgtcgtgtccggtgtctgtgtccgtgcttcatag 6389693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Complemental strand, 10294121 - 10294050
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccg------gtgtccgtatccgtgcttcataga 199  Q
    |||||||||||| ||||  |||||||||||| ||||||||||      ||||||||||||||||||||||||    
10294121 attattagcggtatcggcatgtcagtatccgtgtcgtgtccggtgttcgtgtccgtatccgtgcttcataga 10294050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 30866189 - 30866253
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||| |||||||| || || | ||| |||||||||||||||| ||| ||||||||    
30866189 attattagcggtgttggtgtgtcggtgtcagtgtcatgtccggtgtccgtattcgtacttcatag 30866253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 7938130 - 7938075
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||||| |||  |||||||||||||||||| |||||    
7938130 attattagctgtgtcggcgtgtcagtgtccatgtcgtgtccggtgtccgtgtccgt 7938075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 16766711 - 16766656
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||||| |||  |||||||||||||||||| |||||    
16766711 attattagctgtgtcggcgtgtcagtgtccatgtcgtgtccggtgtccgtgtccgt 16766656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 7977875 - 7977924
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||| ||||||| ||||||||||||  ||||||||| ||||||||    
7977875 attattagctgtgtcggcgtgtcagtatccatgtcgtgtccagtgtccgt 7977924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 9107415 - 9107464
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||| ||||||| |||| ||| |||| ||||||||||||||||||    
9107415 attattagctgtgtcggcgtgttagtgtccgtgtcgtgtccggtgtccgt 9107464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 166 - 199
Target Start/End: Complemental strand, 10649310 - 10649277
Alignment:
166 gtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||| ||||||||||||||||||||||||||||    
10649310 gtcgtatccggtgtccgtatccgtgcttcataga 10649277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 8842344 - 8842280
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||||||  ||||| | |||| ||||| |||||||||||||||||||||||||||    
8842344 attattagcggtgtcggcatgtcaatttccgtgtcgtatccggtgtccgtatccgtgcttcatag 8842280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 134 - 201
Target Start/End: Complemental strand, 8383271 - 8383204
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatagacc 201  Q
    ||||||||||||||||| |||||| | |||| ||||||||| |||||||| |||||||| ||||||||    
8383271 attattagcggtgtcggcgtgtcaatgtccgtgtcgtgtccagtgtccgtgtccgtgctacatagacc 8383204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 4466645 - 4466710
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||||| ||||||||| |||||||| | || ||| |||||||||||||||||| |||||||||||    
4466645 attattaccggtgtcggagtgtcagtgttcgtgtcatgtccggtgtccgtatccatgcttcataga 4466710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 4991014 - 4991067
Alignment:
136 tattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||||||||| |||||||| |||| ||||||| |||||||||| |||||    
4991014 tattagcggtgtcggagtgtcagtctccgtgtcgtgttcggtgtccgtgtccgt 4991067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 144 - 197
Target Start/End: Original strand, 8587076 - 8587129
Alignment:
144 gtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    ||||||| |||||||| |||| ||| ||||||||||||||||| ||||||||||    
8587076 gtgtcggcgtgtcagtgtccgtgtcatgtccggtgtccgtatctgtgcttcata 8587129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 55401089 - 55401025
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||  ||||||| || ||||| |||| ||||| ||||||||||||||| |||||||||||    
55401089 attattagttgtgtcggcgtatcagtgtccgtgtcgtatccggtgtccgtatctgtgcttcatag 55401025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 197
Target Start/End: Original strand, 32429425 - 32429488
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    |||||||||| |||||| |||||| | | || || ||||||||||||||||| |||||||||||    
32429425 attattagcgttgtcggagtgtcaatgttcgtgttgtgtccggtgtccgtatacgtgcttcata 32429488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 199
Target Start/End: Complemental strand, 25064920 - 25064858
Alignment:
137 attagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||||||||||| |||||| | || | ||||||||||||||| ||| ||||| ||||||||    
25064920 attagcggtgtcggcgtgtcaatgtctgtgtcgtgtccggtgtctgtacccgtgtttcataga 25064858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 10335331 - 10335380
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||  ||||||| |||||||| |||| ||||||||||||||||||    
10335331 attattagttgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgt 10335380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 24205086 - 24205135
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||| | ||||||| |||||||| |||| ||||||||||||||||||    
24205086 attattatccgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgt 24205135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 28918015 - 28917966
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    |||||||||  |||||| |||||||| |||| ||||||||||||||||||    
28918015 attattagctatgtcggcgtgtcagtttccgtgtcgtgtccggtgtccgt 28917966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 166 - 199
Target Start/End: Complemental strand, 34910311 - 34910278
Alignment:
166 gtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||||| |||||||||||||||||||||||||    
34910311 gtcgtgtctggtgtccgtatccgtgcttcataga 34910278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 169 - 197
Target Start/End: Original strand, 8789624 - 8789652
Alignment:
169 gtgtccggtgtccgtatccgtgcttcata 197  Q
    |||||||||||||||||||||||||||||    
8789624 gtgtccggtgtccgtatccgtgcttcata 8789652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000003; HSPs: 15)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 40917765 - 40917716
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||| ||||||| ||||||||||||| ||||||||||||||||||    
40917765 attattagctgtgtcggcgtgtcagtatccgtgtcgtgtccggtgtccgt 40917716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 398810 - 398858
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccg 182  Q
    ||||||||||||||||| |||||||| |||| |||||||||||||||||    
398810 attattagcggtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccg 398858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 5927385 - 5927449
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||  | |||||||| |||| |||||||||||||||||||||||||||| ||||    
5927385 attattagcagtgttagcgtgtcagtgtccgtgtcgtgtccggtgtccgtatccgtgcttaatag 5927449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 152 - 199
Target Start/End: Original strand, 39130830 - 39130877
Alignment:
152 gtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||| |||||  ||||||||||||||||||||||||||||||||||    
39130830 gtgtcaatatccatgtcgtgtccggtgtccgtatccgtgcttcataga 39130877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 187
Target Start/End: Original strand, 48040507 - 48040560
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatcc 187  Q
    ||||||| | ||||||| |||||||| |||| ||||||||||||||||||||||    
48040507 attattatctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgtatcc 48040560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 199
Target Start/End: Original strand, 9630634 - 9630690
Alignment:
143 ggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||||| |||||||| |||| || ||||| |||||| ||||||||||||||||||    
9630634 ggtgtcggcgtgtcagtgtccgtgttgtgtctggtgtctgtatccgtgcttcataga 9630690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 10572634 - 10572690
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtg 190  Q
    |||||||| |||||||| |||||||| | |  |||||||||||||||||||||||||    
10572634 attattagtggtgtcggcgtgtcagtgttcatgtcgtgtccggtgtccgtatccgtg 10572690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 35702659 - 35702691
Alignment:
166 gtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||||||||||||||||||||||    
35702659 gtcgtgtccggtgtccgtatccgtgcttcatag 35702691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 38503334 - 38503279
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    |||||||||||||||||||||| ||| |||| ||| ||||| |||||||| |||||    
38503334 attattagcggtgtcggtgtgttagtgtccgtgtcatgtcccgtgtccgtgtccgt 38503279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 180
Target Start/End: Original strand, 20157395 - 20157441
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtc 180  Q
    |||||||||||||||| |||||||||  ||| |||||||||||||||    
20157395 attattagcggtgtcgatgtgtcagtgcccgtgtcgtgtccggtgtc 20157441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 2896166 - 2896215
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||||||||||| |||||||| |||| || ||||||| |||||||    
2896166 attattagcggtgtcggcgtgtcagtgtccgtgttgtgtccgttgtccgt 2896215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 179
Target Start/End: Complemental strand, 34298450 - 34298405
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgt 179  Q
    |||||||| ||||||||||||||||| |||| |||||||| |||||    
34298450 attattagtggtgtcggtgtgtcagtttccgtgtcgtgtctggtgt 34298405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 138 - 199
Target Start/End: Complemental strand, 34315722 - 34315662
Alignment:
138 ttagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||| |||||||  |||||||||||| |||||||||  | |||||||||||||||||||||    
34315722 ttagctgtgtcggcatgtcagtatccgtgtcgtgtcca-tatccgtatccgtgcttcataga 34315662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 10577783 - 10577835
Alignment:
137 attagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    |||||| ||||||| ||||| || |||| |||||||||||||||||| |||||    
10577783 attagctgtgtcggcgtgtcggtgtccgtgtcgtgtccggtgtccgtgtccgt 10577835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 149 - 181
Target Start/End: Original strand, 18190160 - 18190192
Alignment:
149 ggtgtgtcagtatccgcgtcgtgtccggtgtcc 181  Q
    |||||||||||||||| ||||||||||||||||    
18190160 ggtgtgtcagtatccgtgtcgtgtccggtgtcc 18190192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0306
Description:

Target: scaffold0306; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 13414 - 13350
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||  ||||||| |||||||| |||| ||| | |||||||||||||||||||||||||||    
13414 attattagttgtgtcggcgtgtcagtgtccgtgtcatctccggtgtccgtatccgtgcttcatag 13350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0152 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0152
Description:

Target: scaffold0152; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 21913 - 21977
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||  ||||||| |||||||| |||| ||| | |||||||||||||||||||||||||||    
21913 attattagttgtgtcggcgtgtcagtgtccgtgtcatctccggtgtccgtatccgtgcttcatag 21977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 11)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 126394 - 126457
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||| || |||||||||||||  |||||||| |||| ||||||||||||||||||    
126394 attattagcggtgttggcgtgtcagtatccgtatcgtgtcc-gtgtgcgtatccgtgcttcatag 126457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 25192392 - 25192456
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||||| |||||||| ||||  ||||||||| ||||||||| ||||||||||||    
25192392 attattagctgtgtcggcgtgtcagtgtccgtatcgtgtccgatgtccgtattcgtgcttcatag 25192456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 200
Target Start/End: Original strand, 13437009 - 13437075
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatagac 200  Q
    ||||||||| ||||||| |||||||| |||  ||| |||||||||||| | ||||||||||||||||    
13437009 attattagctgtgtcggcgtgtcagtgtccatgtcatgtccggtgtccatgtccgtgcttcatagac 13437075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 156 - 198
Target Start/End: Complemental strand, 40332197 - 40332155
Alignment:
156 cagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||| |||| |||||||||||||||||||||||||||||||||    
40332197 cagtgtccgtgtcgtgtccggtgtccgtatccgtgcttcatag 40332155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 28642422 - 28642358
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||| | |||||  ||||||| | |||| |||||||||| ||||||||||||||||||||||    
28642422 attattaaccgtgtcaatgtgtcattgtccgtgtcgtgtccgatgtccgtatccgtgcttcatag 28642358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 22651990 - 22651935
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||||| |||| ||||||||||||||| || |||||    
22651990 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtcagtgtccgt 22651935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 24362247 - 24362302
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||||||||||| ||||| || || | ||||| ||||||||||||||||||    
24362247 attattagcggtgtcggcgtgtcggtgtctgtgtcgtatccggtgtccgtatccgt 24362302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 181
Target Start/End: Original strand, 29510349 - 29510396
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtcc 181  Q
    ||||||||| ||||||| |||||||| |||| ||||||||||||||||    
29510349 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtcc 29510396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 169 - 199
Target Start/End: Complemental strand, 22595979 - 22595949
Alignment:
169 gtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||||||||||||||||||||||||||||    
22595979 gtgtccggtgtccgtatccgtgcttcataga 22595949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 4298931 - 4298994
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||| | ||||||| |||| |||||| | |||||||||| ||||| ||||||||||||||||    
4298931 attattaactgtgtcggcgtgttagtatctgtgtcgtgtccg-tgtccatatccgtgcttcatag 4298994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 11944679 - 11944615
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||| | ||||||| |||| || ||||| |||||||  |||||||||||| |||||||||||    
11944679 attattaacagtgtcggcgtgttagcatccgtgtcgtgtttggtgtccgtatctgtgcttcatag 11944615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0053 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0053
Description:

Target: scaffold0053; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 8812 - 8757
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||||| |||| |||||||||||||||||| |||||    
8812 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgtgtccgt 8757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 195
Target Start/End: Original strand, 178864 - 178925
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttca 195  Q
    ||||||||  ||||||| |||||||| |||| |||||||||||||||  |||||||||||||    
178864 attattagttgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtcaatatccgtgcttca 178925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 241608 - 241559
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||||| ||||||| |||||||| |||| ||||||||||||||||||    
241608 attattagctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgt 241559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0171 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0171
Description:

Target: scaffold0171; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 135 - 199
Target Start/End: Complemental strand, 23433 - 23370
Alignment:
135 ttattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    |||||| | ||||||| |||||||| || | |||||||||| |||||||||||||||||||||||    
23433 ttattatctgtgtcggcgtgtcagtgtctgtgtcgtgtccg-tgtccgtatccgtgcttcataga 23370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 23293031 - 23293086
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgt 189  Q
    ||||||||| ||||||| |||||| | |||| |||||||||||||||||| |||||    
23293031 attattagctgtgtcggcgtgtcattgtccgtgtcgtgtccggtgtccgtgtccgt 23293086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 198
Target Start/End: Original strand, 7251701 - 7251730
Alignment:
169 gtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||||||||||||||||||||||||    
7251701 gtgtccggtgtccgtatccgtgcttcatag 7251730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 7670677 - 7670632
Alignment:
152 gtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcata 197  Q
    |||||||| ||||||||||||||||| ||| ||| |||||||||||    
7670677 gtgtcagtttccgcgtcgtgtccggtatccatattcgtgcttcata 7670632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 170 - 199
Target Start/End: Complemental strand, 23700449 - 23700420
Alignment:
170 tgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||||||||||||||||||||||||||||    
23700449 tgtccggtgtccgtatccgtgcttcataga 23700420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 166 - 194
Target Start/End: Original strand, 482308 - 482336
Alignment:
166 gtcgtgtccggtgtccgtatccgtgcttc 194  Q
    |||||||||||||||||||||||||||||    
482308 gtcgtgtccggtgtccgtatccgtgcttc 482336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 138 - 194
Target Start/End: Complemental strand, 28084531 - 28084475
Alignment:
138 ttagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttc 194  Q
    ||||| ||||||| |||||||  || | ||||||||||||||||||||| |||||||    
28084531 ttagctgtgtcggcgtgtcagcgtctgtgtcgtgtccggtgtccgtatctgtgcttc 28084475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 199
Target Start/End: Complemental strand, 71737 - 71678
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcataga 199  Q
    ||||||||| ||||||| ||||||||      |||||||||| |||||||||||||||||||||||    
71737 attattagctgtgtcggcgtgtcagt------gtcgtgtccgatgtccgtatccgtgcttcataga 71678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0361 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0361
Description:

Target: scaffold0361; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 168 - 197
Target Start/End: Complemental strand, 14527 - 14498
Alignment:
168 cgtgtccggtgtccgtatccgtgcttcata 197  Q
    ||||||||||||||||||||||||||||||    
14527 cgtgtccggtgtccgtatccgtgcttcata 14498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 225313 - 225362
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgt 183  Q
    ||||||| | ||||||| |||||||| |||| ||||||||||||||||||    
225313 attattatctgtgtcggcgtgtcagtgtccgtgtcgtgtccggtgtccgt 225362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0066 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 33432 - 33464
Alignment:
166 gtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    |||||||||||||||| ||||||||||||||||    
33432 gtcgtgtccggtgtccttatccgtgcttcatag 33464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0020 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0020
Description:

Target: scaffold0020; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 198
Target Start/End: Original strand, 135357 - 135421
Alignment:
134 attattagcggtgtcggtgtgtcagtatccgcgtcgtgtccggtgtccgtatccgtgcttcatag 198  Q
    ||||||||| ||||||||||||  || || | ||||| | |||||||||||||| ||||||||||    
135357 attattagcagtgtcggtgtgttggtgtctgtgtcgtattcggtgtccgtatccatgcttcatag 135421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151192 times since January 2019
Visitors: 1526