View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_31 (Length: 346)

Name: NF0095_high_31
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_31
NF0095_high_31
[»] chr3 (6 HSPs)
chr3 (10-317)||(1320493-1320800)
chr3 (9-128)||(1336444-1336563)
chr3 (192-315)||(1336007-1336127)
chr3 (9-126)||(1264101-1264218)
chr3 (198-315)||(1264310-1264427)
chr3 (10-66)||(1253519-1253575)


Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 10 - 317
Target Start/End: Complemental strand, 1320800 - 1320493
Alignment:
10 aagaatatcatatcacaaaatgagttgatatcactatgggagctcaaaagtggtcaaaaatttcataaagtttttattccagaggaagatattgtcaagc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
1320800 aagaatatcatatcacaaaatgagttgatatcactatgggagctcaaaagtggtcaaaaatttcataaagtttttgttccagaggaagatattgtcaagc 1320701  T
110 tatcacaaagtaagactttaatttgtttttactaatgatgtgtaaatataatacatatacaagcttacattgataatatatgtttatgatgcagctttac 209  Q
    ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
1320700 tatcacaaagtaatactttaatttgtttttactaatgttgtgtaaatataatacatatacaagcttacattggtaatatatgtttatgatgcagctttac 1320601  T
210 cccctccagaagatattccaatttccatcattcatagcatatttgttagaggtgacatggcaaactttgagctagaggaagatgatcttgaaggttcaca 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1320600 cccctccagaagatattccaatttccatcattcatagcatatttgttagaggtgacatggcaaactttgagctagaggaagatgatcttgaagcttcaca 1320501  T
310 actatacc 317  Q
    ||||||||    
1320500 actatacc 1320493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 9 - 128
Target Start/End: Complemental strand, 1336563 - 1336444
Alignment:
9 gaagaatatcatatcacaaaatgagttgatatcactatgggagctcaaaagtggtcaaaaatttcataaagtttttattccagaggaagatattgtcaag 108  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | ||||| ||| ||||||| ||||||||| |||||    
1336563 gaagaatatcatatcacaaaatgagttgatatcactatgggaactcaaaagtggtcaaaactttaacaaagtatttgttccagaagaagatattatcaag 1336464  T
109 ctatcacaaagtaagacttt 128  Q
    ||||||||||||||||||||    
1336463 ctatcacaaagtaagacttt 1336444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 192 - 315
Target Start/End: Complemental strand, 1336127 - 1336007
Alignment:
192 tttatgatgcagctttaccccctccagaagatattccaatttccatcattcatagcatatttgttagaggtgacatggcaaactttgagctagaggaaga 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||    ||||||||||||||||| |    
1336127 tttatgatgcagctttaccccctccagaagatattccaatttccatcgttcatagcatatttgttaaaggcgacatg---tactttgagctagaggaaaa 1336031  T
292 tgatcttgaaggttcacaactata 315  Q
    ||| ||||||| ||||||||||||    
1336030 tgaccttgaagcttcacaactata 1336007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 9 - 126
Target Start/End: Original strand, 1264101 - 1264218
Alignment:
9 gaagaatatcatatcacaaaatgagttgatatcactatgggagctcaaaagtggtcaaaaatttcataaagtttttattccagaggaagatattgtcaag 108  Q
    ||||||| | ||| ||||||||||||||||||||||||||||||| |||| ||||||||   || | |||||||||  |||||| |||||||||||||||    
1264101 gaagaattttataacacaaaatgagttgatatcactatgggagcttaaaaatggtcaaatccttaacaaagtttttgctccagaagaagatattgtcaag 1264200  T
109 ctatcacaaagtaagact 126  Q
    ||||||||||||||||||    
1264201 ctatcacaaagtaagact 1264218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 198 - 315
Target Start/End: Original strand, 1264310 - 1264427
Alignment:
198 atgcagctttaccccctccagaagatattccaatttccatcattcatagcatatttgttagaggtgacatggcaaactttgagctagaggaagatgatct 297  Q
    |||||| ||||||||||||| |  |||| ||| |||||||  |||||||  ||||||||  ||| ||| | |  ||||||||||||||||||||||| ||    
1264310 atgcagttttaccccctccacacaatataccagtttccattcttcatagtgtatttgttcaaggggaccttgtgaactttgagctagaggaagatgacct 1264409  T
298 tgaaggttcacaactata 315  Q
    ||||| ||||||||||||    
1264410 tgaagcttcacaactata 1264427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 66
Target Start/End: Original strand, 1253519 - 1253575
Alignment:
10 aagaatatcatatcacaaaatgagttgatatcactatgggagctcaaaagtggtcaa 66  Q
    |||||| | ||| |||||||||||||||||| |||||||||||| |||| |||||||    
1253519 aagaattttataacacaaaatgagttgatataactatgggagcttaaaaatggtcaa 1253575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150974 times since January 2019
Visitors: 1524