View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_32 (Length: 322)

Name: NF0095_high_32
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_32
NF0095_high_32
[»] chr2 (8 HSPs)
chr2 (1-306)||(39825447-39825752)
chr2 (148-306)||(39805416-39805574)
chr2 (41-315)||(39910384-39910654)
chr2 (175-315)||(39926991-39927131)
chr2 (175-315)||(39813926-39814066)
chr2 (175-315)||(39921703-39921843)
chr2 (129-315)||(39902035-39902221)
chr2 (41-119)||(39814162-39814240)


Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 39825752 - 39825447
Alignment:
1 ataggatttgaactgtgtgcaatctaacttcacgagtcaactgtcagccacatctagaccgtctgatcaagattgaacgtttaagatgtggctgactggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39825752 ataggatttgaactgtgtgcaatctaacttcacgagtcaactgtcagccacatctagaccgtctgatcaagattgaacgtttaagatgtggctgactggt 39825653  T
101 tacaataacgagagtatgaatgaatgcacacaacatatatccttacaagtaacaatttaccaatactaggatttcgtaccggtttgagattgacatgata 200  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||    
39825652 tacaataaggagagtatgaatgaatgcacacaacatatatccttacatgtaacaatttaccaatactaggattgcgtaccggtttgagattgacatgata 39825553  T
201 aatgccaatgccggaacttttgagtggagaataatcagaaccgtctagagcaacactccaaccataactatttttgaaatctggttttctatcatagagg 300  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39825552 aatgccaatgccataacttttgagtggagaataatcagaaccgtctagagcaacactccaaccataactatttttgaaatctggttttctatcatagagg 39825453  T
301 ttgcaa 306  Q
    ||||||    
39825452 ttgcaa 39825447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 148 - 306
Target Start/End: Complemental strand, 39805574 - 39805416
Alignment:
148 agtaacaatttaccaatactaggatttcgtaccggtttgagattgacatgataaatgccaatgccggaacttttgagtggagaataatcagaaccgtcta 247  Q
    ||||| |||||| ||||||||  ||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||    
39805574 agtaaaaatttaacaatactaaaattgcgtactggtttgagattgacgtgataaatgccaatgccggaacttttgagtggagaatagtcagaaccgtcta 39805475  T
248 gagcaacactccaaccataactatttttgaaatctggttttctatcatagaggttgcaa 306  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
39805474 gagcaacactccaaccataactattttggaaatctggttttctatcatagaggttgcaa 39805416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 41 - 315
Target Start/End: Complemental strand, 39910654 - 39910384
Alignment:
41 ctgtcagccacatctagaccgtctgatcaagattgaacgtttaagatgtggctgactggttacaataacgagagtatgaatgaatgcacacaacatatat 140  Q
    ||||| |||||||||||||||||||||   ||||||||||||||||| |||||||| ||||||||||||| || ||| | |     |||||||| || ||    
39910654 ctgtctgccacatctagaccgtctgatattgattgaacgtttaagatctggctgaccggttacaataacgggattataacta----cacacaacctagat 39910559  T
141 ccttacaagtaacaatttaccaatactaggatttcgtaccggtttgagattgacatgataaatgccaatgccggaacttttgagtggagaataatcagaa 240  Q
    ||| |||| |||  || ||   ||| |||| |  |||||||||||||||||||| |||||||| ||||  ||||||||||| ||||| ||||||||||||    
39910558 cctaacaaataaacatataaatataataggctagcgtaccggtttgagattgacgtgataaattccaacaccggaacttttaagtggtgaataatcagaa 39910459  T
241 ccgtctagagcaacactccaaccataactatttttgaaatctggttttctatcatagaggttgcaacagctaggg 315  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||| ||| ||||    
39910458 ccgtctagagcaacactccaaccataactgttcttgaaatctggttttctgtcatagaggttgcaagagcgaggg 39910384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 175 - 315
Target Start/End: Complemental strand, 39927131 - 39926991
Alignment:
175 cgtaccggtttgagattgacatgataaatgccaatgccggaacttttgagtggagaataatcagaaccgtctagagcaacactccaaccataactatttt 274  Q
    |||||||||||||||||||| |||||||| |||| |||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| ||||    
39927131 cgtaccggtttgagattgacgtgataaattccaacgccggaacttttaagtggtgaataatcagaaccgtccagagcaacactccaaccataactgtttt 39927032  T
275 tgaaatctggttttctatcatagaggttgcaacagctaggg 315  Q
    |||||||||||||||| ||||||||||||||| ||| ||||    
39927031 tgaaatctggttttctgtcatagaggttgcaagagcgaggg 39926991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 175 - 315
Target Start/End: Complemental strand, 39814066 - 39813926
Alignment:
175 cgtaccggtttgagattgacatgataaatgccaatgccggaacttttgagtggagaataatcagaaccgtctagagcaacactccaaccataactatttt 274  Q
    |||||||||||||||||||| |||||||| |||| |||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| || |    
39814066 cgtaccggtttgagattgacgtgataaattccaacgccggaacttttaagtggtgaataatcagaaccgtctagagaaacactccaaccataactgttct 39813967  T
275 tgaaatctggttttctatcatagaggttgcaacagctaggg 315  Q
    |||||||||||||||| ||||||||||||||| ||| ||||    
39813966 tgaaatctggttttctgtcatagaggttgcaagagcgaggg 39813926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 175 - 315
Target Start/End: Complemental strand, 39921843 - 39921703
Alignment:
175 cgtaccggtttgagattgacatgataaatgccaatgccggaacttttgagtggagaataatcagaaccgtctagagcaacactccaaccataactatttt 274  Q
    |||||||||||||||||||| |||||||| |||| |||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||| || |    
39921843 cgtaccggtttgagattgacgtgataaattccaacgccggaacttttaagtggtgaataatcagaaccatctagagcaacactccaaccataactgttct 39921744  T
275 tgaaatctggttttctatcatagaggttgcaacagctaggg 315  Q
    |||||||||||||||| ||||||||||||||| ||| ||||    
39921743 tgaaatctggttttctgtcatagaggttgcaagagcgaggg 39921703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 129 - 315
Target Start/End: Complemental strand, 39902221 - 39902035
Alignment:
129 cacaacatatatccttacaagtaacaatttaccaatactaggatttcgtaccggtttgagattgacatgataaatgccaatgccggaacttttgagtgga 228  Q
    |||||| |||||| || ||| |||  ||||| ||||| |||| |  ||||||||||| ||||||||||| ||||| |||||||| |||||||| |||||     
39902221 cacaacctatatcattgcaaataaacatttaacaataataggctagcgtaccggtttaagattgacatggtaaattccaatgccagaacttttaagtggt 39902122  T
229 gaataatcagaaccgtctagagcaacactccaaccataactatttttgaaatctggttttctatcatagaggttgcaacagctaggg 315  Q
    |||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||||| ||| ||||    
39902121 gaataatcagaaccgtctagagaaacactccaaccataactgttcttgaaatctggttttctgtcatagaggttgcaagagcgaggg 39902035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 41 - 119
Target Start/End: Complemental strand, 39814240 - 39814162
Alignment:
41 ctgtcagccacatctagaccgtctgatcaagattgaacgtttaagatgtggctgactggttacaataacgagagtatga 119  Q
    ||||| ||||||||||||||||||||||  |||| |||||||||||| |||||||| | ||||||||||| || |||||    
39814240 ctgtctgccacatctagaccgtctgatcttgattaaacgtttaagatctggctgaccgattacaataacgggattatga 39814162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151115 times since January 2019
Visitors: 1526