View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_33 (Length: 321)

Name: NF0095_high_33
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_33
NF0095_high_33
[»] chr2 (10 HSPs)
chr2 (1-158)||(39825728-39825885)
chr2 (238-292)||(39922125-39922179)
chr2 (238-292)||(39825963-39826017)
chr2 (238-292)||(39902524-39902578)
chr2 (238-292)||(39910982-39911036)
chr2 (238-292)||(39927821-39927875)
chr2 (254-292)||(39805615-39805653)
chr2 (250-292)||(39814896-39814938)
chr2 (62-104)||(39902359-39902401)
chr2 (14-96)||(39910683-39910764)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 10)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 39825728 - 39825885
Alignment:
1 agattgcacacagttcaaatcctattcgcaatagtcttttgataaatggtccatgaaaacaagttggataacaacataattgttttttatgttgtcgtaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
39825728 agattgcacacagttcaaatcctattcgcaatagtcttttgataaatggtccatgacaacaagttggataacaacataattgttttttatgttgtcgtaa 39825827  T
101 ccacaactcttgcaattgaggatgcatcgtcaacatttgatcaagggaacagttactc 158  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
39825828 ccacaactcttgcaattgaggatgcatcgtcaacatttgatcacgggaacagttactc 39825885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39922125 - 39922179
Alignment:
238 tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39922125 tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc 39922179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39825963 - 39826017
Alignment:
238 tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
39825963 tcttttgcattcaatctatatggcagggatccatgatgacaccccatgtaaatcc 39826017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39902524 - 39902578
Alignment:
238 tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||    
39902524 tcttttgcattcaatttatatggcagggatccatgatgacaccccatgtaaatcc 39902578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39910982 - 39911036
Alignment:
238 tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||    
39910982 tcttttgcattcaatttatatggcagggatccatgatgacaccccatgtaaatcc 39911036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 39927821 - 39927875
Alignment:
238 tcttttgcattaaatctatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||    
39927821 tcttttgcattcaatttatatggcagggatccatgatgacaccccatgtaaatcc 39927875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 254 - 292
Target Start/End: Original strand, 39805615 - 39805653
Alignment:
254 tatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    |||||||||||||||||||||||||||||||||||||||    
39805615 tatatggcagggatccatgatgacaccccatgtaaatcc 39805653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 250 - 292
Target Start/End: Original strand, 39814896 - 39814938
Alignment:
250 aatctatatggcagggatccatgatgacaccccatgtaaatcc 292  Q
    ||||||| || ||||||||||||||||||||||||||||||||    
39814896 aatctatgtgacagggatccatgatgacaccccatgtaaatcc 39814938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 104
Target Start/End: Original strand, 39902359 - 39902401
Alignment:
62 agttggataacaacataattgttttttatgttgtcgtaaccac 104  Q
    ||||||||| ||| |||||||||||| ||||||||||||||||    
39902359 agttggatagcaaaataattgtttttgatgttgtcgtaaccac 39902401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 39910683 - 39910764
Alignment:
14 ttcaaatcctattcgcaatagtcttttgataaatggtccatgaaaacaagttggataacaacataattgttttttatgttgtc 96  Q
    ||||||||| |||| ||||| |||||  ||| ||| ||| ||| ||| ||||||||| |||||||||||||||| ||||||||    
39910683 ttcaaatccaattcacaatattctttcaatagatg-tccttgacaacgagttggatatcaacataattgtttttgatgttgtc 39910764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151270 times since January 2019
Visitors: 1526