View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_36 (Length: 310)

Name: NF0095_high_36
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_36
[»] chr6 (2 HSPs)
chr6 (42-286)||(31523776-31524020)
chr6 (18-51)||(31523709-31523742)
[»] chr8 (7 HSPs)
chr8 (122-218)||(15128381-15128477)
chr8 (140-218)||(5279577-5279655)
chr8 (140-222)||(5316437-5316519)
chr8 (148-241)||(14946588-14946681)
chr8 (140-207)||(5309804-5309871)
chr8 (140-222)||(5287309-5287391)
chr8 (40-77)||(35144595-35144632)
[»] chr4 (1 HSPs)
chr4 (42-78)||(19262985-19263021)

Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 42 - 286
Target Start/End: Original strand, 31523776 - 31524020
42 gtgtcgtgtccggtgtctgtgtttgtgcttcatagatgattatatattttccttaacgttgaaagagtaacgttgcatgcatgcaacagattgttgccaa 141  Q
31523776 gtgtcgtgtccggtgtctgtgtttgtgcttcatagatgattatatattttccttaacgttgaaagagtaacgttgcatgcatgcaacagattgttgccaa 31523875  T
142 agactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatataacaaacaaatctaatcaaa 241  Q
31523876 agactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatataacaaacaaatctaatcaaa 31523975  T
242 attcaaatacattttgtatgtaggtacatatatttttctgtgatg 286  Q
31523976 attcaaatacattttgtatgtaggtacatatatttttctgtgatg 31524020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 31523742 - 31523709
18 ttaattaattgaatgtaatcacttgtgtcgtgtc 51  Q
31523742 ttaattaattgaatgtaatcacttgtgtcgtgtc 31523709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 7)
Name: chr8

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 218
Target Start/End: Complemental strand, 15128477 - 15128381
122 atgcaacagattgttgccaaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaa 218  Q
    |||||| |||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||| | ||||||||    
15128477 atgcaatagattgttgccaaagatttaccagaagagtccaagagacttggtagcttgctgattgtttccttaagctgacatttctctacagcctaaa 15128381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 140 - 218
Target Start/End: Original strand, 5279577 - 5279655
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaa 218  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||| | ||||||||    
5279577 aaagacttaccagaagagtccaagagacttggtagcttgctgattgtttccttaagctgacatttctctacagcctaaa 5279655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 5316519 - 5316437
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatata 222  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||||||||| || |||||||| |  | ||||||||||||    
5316519 aaagacttaccagaagagtccaagagacttggtagcttgctgattgtttccttaagctgacatttttttacagcctaaatata 5316437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 148 - 241
Target Start/End: Original strand, 14946588 - 14946681
148 accagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatataacaaacaaatctaatcaaa 241  Q
    |||||||||||||||||||||||||||| ||| |||||||||||| || ||||||||||| | |||||||| |||  || ||||| ||||||||    
14946588 accagaagagtccaagagacttggtagcttgcagattgtttccttaagctgacatttctctacagcctaaacatacaaatcaaatataatcaaa 14946681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 140 - 207
Target Start/End: Complemental strand, 5309871 - 5309804
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctc 207  Q
    ||||||| ||||||||||||||||||||||| |||| |||||||||||||||| || |||||||||||    
5309871 aaagacttaccagaagagtccaagagacttgatagcttgctgattgtttccttaagctgacatttctc 5309804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 140 - 222
Target Start/End: Original strand, 5287309 - 5287391
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatata 222  Q
    ||||||| |||||||||||| |||||| |||||||| |||||||||||||||| || |||||||| || | ||||||||||||    
5287309 aaagacttaccagaagagtctaagagatttggtagcttgctgattgtttccttaagctgacatttttctacagcctaaatata 5287391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 77
Target Start/End: Complemental strand, 35144632 - 35144595
40 ttgtgtcgtgtccggtgtctgtgtttgtgcttcataga 77  Q
    |||||||||||||||| ||| |||||||||||||||||    
35144632 ttgtgtcgtgtccggtctctatgtttgtgcttcataga 35144595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 78
Target Start/End: Original strand, 19262985 - 19263021
42 gtgtcgtgtccggtgtctgtgtttgtgcttcatagat 78  Q
    ||||||||||||||||||||||| |||||||| ||||    
19262985 gtgtcgtgtccggtgtctgtgttcgtgcttcacagat 19263021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150892 times since January 2019
Visitors: 1524