View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_37 (Length: 308)

Name: NF0095_high_37
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_37
NF0095_high_37
[»] chr5 (1 HSPs)
chr5 (1-225)||(38816155-38816379)


Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 38816379 - 38816155
Alignment:
1 ttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38816379 ttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgt 38816280  T
101 ctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38816279 ctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcact 38816180  T
201 gagttatgataattgtgcatgtgat 225  Q
    |||||||||||||||||||||||||    
38816179 gagttatgataattgtgcatgtgat 38816155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126559 times since January 2019
Visitors: 1391