View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_38 (Length: 307)

Name: NF0095_high_38
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_38
[»] chr2 (1 HSPs)
chr2 (32-300)||(9593404-9593672)

Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 32 - 300
Target Start/End: Complemental strand, 9593672 - 9593404
32 ttctaggacagagaaagaggttaagtaagaaaaaaggcactttcatttcaacctataattacatgagtcattaaataggtctgttctgacatctggttta 131  Q
9593672 ttctaggacagagaaagaggttaagtaagaaaaaaggcactttcatttcaacctataattacatgagtcattaaataggtctgttctgacatctggttta 9593573  T
132 gcatttaaggatttataaatgaaaagaaagnnnnnnntgtggttttttgagctcctttattgtatgtctaggaagaagtagtaatcagtttcttcatccc 231  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9593572 gcatttaaggatttataaatgaaaagaaagaaaaaaatgtggttttttgagctcctttattgtatgtctaggaagaagtagtaatcagtttcttcatccc 9593473  T
232 tagaaagaaagtgtgattataggagtgtcttaatttctgtcaatttattatgccccatttcctttgttt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
9593472 tagaaagaaagtgtgattataggagtgtcttaatttctgtcaatttattatgccccatttcttttgttt 9593404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126658 times since January 2019
Visitors: 1391