View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_4 (Length: 552)

Name: NF0095_high_4
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_4
NF0095_high_4
[»] chr4 (2 HSPs)
chr4 (31-460)||(44969649-44970078)
chr4 (461-523)||(44969439-44969501)


Alignment Details
Target: chr4 (Bit Score: 371; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 31 - 460
Target Start/End: Complemental strand, 44970078 - 44969649
Alignment:
31 atgttttcaacgttcaatttaaggtgtcctatttataannnnnnnnccttctcatttattgatataattattggtgttggctttgttttgcagtttttct 130  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44970078 atgttttcaacgttcaatttaaggtgtcctatttataattttttt-ccttctcatttattgatataattattggtgttggctttgttttgcagtttttct 44969980  T
131 tgttcaagttcaacaaggaaggcagaatataatgagttttgactgtttcatcgcgtgctctatagtcccataacatggtatcaaagttttaactaattct 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||| |||||||    
44969979 tgttcaagttcaacaaggaaggcagaatataatgagttttgactgtttcatcgcgtgctcta--gtcccataacatggtatcaaagttttaattaattct 44969882  T
231 cttatggttaataat---ttgcggtgaatggatggaagacgacacatctcacatggtggtgaccttgagtaagtcaggctataccttttgaaaagaaaag 327  Q
    |||||||||||||||   |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44969881 cttatggttaataataatttgcggtgaatggatggaagtcgacacatctcacatggtggtgaccttgagtaagtcaggctataccttttgaaaagaaaag 44969782  T
328 atgaaggatatgtttcatgtagtgtagttggataataagaccgacgatgagtggaccctactatacaaacatgtgtgcatatacatttgttagttagtgg 427  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44969781 atgaaggatatgtttcatgtagtgtagttggataataagaccgacgatgagtggaccctactatacaaacatgtgtgcatatacatttgttagttagtgg 44969682  T
428 gttgatgataatcttttgaaccattttaatggg 460  Q
    |||||||||||||||||||||||||||||||||    
44969681 gttgatgataatcttttgaaccattttaatggg 44969649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 461 - 523
Target Start/End: Complemental strand, 44969501 - 44969439
Alignment:
461 ttgatgatgaaattttaaggttattgcctcttcttaatccttgcatggcttgtgggaaacttt 523  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44969501 ttgatgatgaaattttaaggttattgcctcttcttaatccttgcatggcttgtgggaaacttt 44969439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126583 times since January 2019
Visitors: 1391