View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_41 (Length: 279)

Name: NF0095_high_41
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_41
[»] chr8 (4 HSPs)
chr8 (146-211)||(20874528-20874592)
chr8 (54-101)||(20874480-20874527)
chr8 (147-246)||(20311205-20311305)
chr8 (147-246)||(21104842-21104942)
[»] chr1 (2 HSPs)
chr1 (147-205)||(30497471-30497529)
chr1 (149-185)||(11104875-11104911)
[»] chr7 (1 HSPs)
chr7 (177-245)||(5290753-5290821)
[»] chr4 (1 HSPs)
chr4 (147-238)||(13977908-13977999)
[»] chr5 (1 HSPs)
chr5 (147-246)||(19903035-19903133)

Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 20874528 - 20874592
146 ggtgtgtttgagcatttgtaatcttagtaactatagtgaacatcccttggaagtgaaagggaacta 211  Q
    |||||||||||||||||||||||||||| ||||||||||||||| |||||||  ||||||||||||    
20874528 ggtgtgtttgagcatttgtaatcttagt-actatagtgaacatctcttggaaacgaaagggaacta 20874592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 101
Target Start/End: Original strand, 20874480 - 20874527
54 tgatgaggagactttgacagtcctgcgggaatggattcaacatgagcc 101  Q
    ||||||||||||||| ||||| ||||||||||||||||||||||||||    
20874480 tgatgaggagactttcacagttctgcgggaatggattcaacatgagcc 20874527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 20311305 - 20311205
147 gtgtgtttgagcatttgtaatc-ttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataa 245  Q
    ||||||||| |||||||||||| ||| | | ||||||||| || | ||| ||||| ||||| ||||||||| ||||||||||  || |||||| ||||||    
20311305 gtgtgtttgggcatttgtaatctttaatgattatagtgaaaattcattgaaagtgcaaggggactatactactctcgatttgtaaggggaactagtataa 20311206  T
246 a 246  Q
20311205 a 20311205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 21104942 - 21104842
147 gtgtgtttgagcatttgtaatc-ttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataa 245  Q
    ||||||||| |||||||||||| ||| | | ||||||||| || | ||| ||||| ||||| ||||||||| ||||||||||  || |||||| ||||||    
21104942 gtgtgtttgggcatttgtaatctttaatgattatagtgaaaattcattgaaagtgcaaggggactatactactctcgatttgtaaggggaactagtataa 21104843  T
246 a 246  Q
21104842 a 21104842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 30497529 - 30497471
147 gtgtgtttgagcatttgtaatcttagtaactatagtgaacatcccttggaagtgaaagg 205  Q
    ||||| ||||||||||||||||||  ||| ||||||||| ||| |||||||||||||||    
30497529 gtgtgcttgagcatttgtaatctttttaattatagtgaaaatctcttggaagtgaaagg 30497471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 11104911 - 11104875
149 gtgtttgagcatttgtaatcttagtaactatagtgaa 185  Q
    |||||||| |||||||||||||||||| |||||||||    
11104911 gtgtttgaacatttgtaatcttagtaattatagtgaa 11104875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 245
Target Start/End: Original strand, 5290753 - 5290821
177 tatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataa 245  Q
    ||||||||||||||||| |||||| ||||| |||  |||| |||||||||| | |||||||| ||||||    
5290753 tatagtgaacatcccttagaagtgcaaggggactggactactctcgatttgtgggaggaactagtataa 5290821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 238
Target Start/End: Original strand, 13977908 - 13977999
147 gtgtgtttgagcatttgtaatc-ttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaact 238  Q
    ||||| |||||||||||||||| ||||| | ||||||||| || |||| |||||| ||||| |||| |||| ||||| |||| ||||||||||    
13977908 gtgtgcttgagcatttgtaatctttagtgattatagtgaaaattcctt-gaagtgcaaggggactagactactctcggtttgtgagaggaact 13977999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 19903133 - 19903035
147 gtgtgtttgagcatttgtaatcttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataaa 246  Q
    ||||| |||||||||||||||||||||   |||| |||| |||| || ||||||  |||| |||| |||| ||||| |||| |||||||||| |||||||    
19903133 gtgtgcttgagcatttgtaatcttagtgtttatattgaaaatccttttgaagtgccaggg-actagactactctcggtttgtgagaggaactagtataaa 19903035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150860 times since January 2019
Visitors: 1524