View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_42 (Length: 276)

Name: NF0095_high_42
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_42
[»] chr7 (1 HSPs)
chr7 (1-224)||(42341796-42342018)

Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 42342018 - 42341796
1 cttgatcatatatacataagaatttcaaataattcatacatttgtggatacataattttagatttaagtataatatgattggttaaaatttcaggaacct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
42342018 cttgatcatatatacataagaatttcaaataattcatacatttgtggatacataattttagatt-aagtataatatgattggttaaaatttcaggaacct 42341920  T
101 gttttctggctctagatcttgctgctgactctctattcttgatcatcctcctctgccttctctccaccaccctttcaacaggaccatcaaccatcctctt 200  Q
42341919 gttttctggctctagatcttgctgctgactctctattcttgatcatcctcctctgccttctctccaccaccctttcaacaggaccatcaaccatcctctt 42341820  T
201 tcttcctcgtaaaccattcatatc 224  Q
42341819 tcttcctcgtaaaccattcatatc 42341796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126533 times since January 2019
Visitors: 1391