View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_43 (Length: 270)

Name: NF0095_high_43
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_43
[»] chr4 (1 HSPs)
chr4 (30-257)||(34524333-34524556)
[»] chr5 (1 HSPs)
chr5 (152-230)||(1734611-1734689)

Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 34524333 - 34524556
30 gatgttagatcccacaagttggatctcaaatgaaccaa-----gttcaagtcaatcaacaaaagcatcgcaattggacaattggtgtaattgttgttcat 124  Q
    ||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||         ||||    
34524333 gatgttagatcccacaagttggatctcaaatgaaccaaaccaagttcaagtcaatcaacaaaagcatcgcaattggacaattggtgt---------tcat 34524423  T
125 cgtttccctaaccatgcacattcctacttggttaggagacttttcttttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatct 224  Q
    ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
34524424 cgtttccctaaccatgcacattcctacttggttaggagagttttctcttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatct 34524523  T
225 atttcaataccattccaccgttgtagagcctct 257  Q
    ||||||||| |||||||||||||||||||||||    
34524524 atttcaatatcattccaccgttgtagagcctct 34524556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 230
Target Start/End: Original strand, 1734611 - 1734689
152 ttggttaggagacttttcttttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatctatttca 230  Q
    |||||||||||| |||||| |   |||| ||||||| ||||||| ||| |||||||||||||||||||||||| |||||    
1734611 ttggttaggagagttttctctctggttatgagcataatgctctgttgaggagttcttgaactatggtttatctctttca 1734689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151167 times since January 2019
Visitors: 1526