View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_44 (Length: 269)

Name: NF0095_high_44
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_44
NF0095_high_44
[»] chr6 (1 HSPs)
chr6 (155-242)||(1807604-1807699)


Alignment Details
Target: chr6 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 155 - 242
Target Start/End: Original strand, 1807604 - 1807699
Alignment:
155 aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttt--------tcaaattttcatcatggatcttgagtctgtg 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||    
1807604 aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttttcaaaacatcaaattttcatcatggatcttgagtctgtg 1807699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150258 times since January 2019
Visitors: 1519