View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_44 (Length: 269)
Name: NF0095_high_44
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 155 - 242
Target Start/End: Original strand, 1807604 - 1807699
Alignment:
Q |
155 |
aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttt--------tcaaattttcatcatggatcttgagtctgtg |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
1807604 |
aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttttcaaaacatcaaattttcatcatggatcttgagtctgtg |
1807699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 150258 times since January 2019
Visitors: 1519